Incidental Mutation 'R6663:Slc35b3'
ID526883
Institutional Source Beutler Lab
Gene Symbol Slc35b3
Ensembl Gene ENSMUSG00000021432
Gene Namesolute carrier family 35, member B3
Synonyms4921526O06Rik, PAPST2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location38932136-38960875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38954136 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 99 (L99P)
Ref Sequence ENSEMBL: ENSMUSP00000153154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021870] [ENSMUST00000167513] [ENSMUST00000224429] [ENSMUST00000224645] [ENSMUST00000225331] [ENSMUST00000225432] [ENSMUST00000225461] [ENSMUST00000225568] [ENSMUST00000225714]
AlphaFold Q922Q5
Predicted Effect probably damaging
Transcript: ENSMUST00000021870
AA Change: L143P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021870
Gene: ENSMUSG00000021432
AA Change: L143P

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:UAA 92 383 3.5e-95 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167513
AA Change: L99P

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126016
Gene: ENSMUSG00000021432
AA Change: L99P

DomainStartEndE-ValueType
Pfam:UAA 49 343 4e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223619
Predicted Effect probably benign
Transcript: ENSMUST00000224429
Predicted Effect probably benign
Transcript: ENSMUST00000224645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224854
Predicted Effect probably damaging
Transcript: ENSMUST00000225331
AA Change: L99P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225432
AA Change: L99P

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000225461
AA Change: L99P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000225568
Predicted Effect probably damaging
Transcript: ENSMUST00000225714
AA Change: L99P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6366 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family. The encoded protein is involved in the transport of 3-prime phosphoadenosine 5-prime phosphosulfate (PAPS) from the nucleus or the cytosol to the Golgi lumen. This gene has been reported to be expressed preferentially in the human colon tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Slc35b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Slc35b3 APN 13 38943140 missense possibly damaging 0.82
IGL02111:Slc35b3 APN 13 38955782 missense probably damaging 0.99
R0883:Slc35b3 UTSW 13 38937275 missense probably benign 0.09
R1170:Slc35b3 UTSW 13 38937331 missense probably benign 0.03
R1440:Slc35b3 UTSW 13 38954134 nonsense probably null
R1653:Slc35b3 UTSW 13 38955798 missense probably benign 0.02
R1900:Slc35b3 UTSW 13 38960611 critical splice donor site probably null
R3874:Slc35b3 UTSW 13 38943068 missense possibly damaging 0.66
R3897:Slc35b3 UTSW 13 38934763 missense probably benign 0.09
R4399:Slc35b3 UTSW 13 38937815 missense possibly damaging 0.95
R4937:Slc35b3 UTSW 13 38932911 missense possibly damaging 0.89
R4955:Slc35b3 UTSW 13 38932890 missense probably benign 0.08
R5034:Slc35b3 UTSW 13 38943158 missense probably damaging 1.00
R5770:Slc35b3 UTSW 13 38937758 missense probably damaging 0.98
R6155:Slc35b3 UTSW 13 38944596 missense probably damaging 1.00
R7701:Slc35b3 UTSW 13 38944635 missense probably benign 0.03
R8534:Slc35b3 UTSW 13 38944590 missense probably benign 0.17
R8796:Slc35b3 UTSW 13 38937746 critical splice donor site probably benign
R8950:Slc35b3 UTSW 13 38954121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACACCGCACTTCAAAC -3'
(R):5'- GCATGTGTTATCTTATGAAGCCTTG -3'

Sequencing Primer
(F):5'- GCACTTCAAACTTTTTATCCAGTG -3'
(R):5'- TGGCTTAGTTTCTTTTAAATCGAGC -3'
Posted On2018-07-23