Incidental Mutation 'R6663:Irx2'
ID526884
Institutional Source Beutler Lab
Gene Symbol Irx2
Ensembl Gene ENSMUSG00000001504
Gene NameIroquois homeobox 2
SynonymsIRX6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R6663 (G1)
Quality Score80.0075
Status Validated
Chromosome13
Chromosomal Location72628820-72634198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72629129 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 23 (Y23C)
Ref Sequence ENSEMBL: ENSMUSP00000073976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074372] [ENSMUST00000167067] [ENSMUST00000172353]
Predicted Effect probably damaging
Transcript: ENSMUST00000074372
AA Change: Y23C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073976
Gene: ENSMUSG00000001504
AA Change: Y23C

DomainStartEndE-ValueType
low complexity region 51 64 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
HOX 115 180 1.14e-12 SMART
low complexity region 188 196 N/A INTRINSIC
low complexity region 256 278 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
IRO 325 342 2.28e-5 SMART
low complexity region 346 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163393
Predicted Effect probably benign
Transcript: ENSMUST00000167067
SMART Domains Protein: ENSMUSP00000127963
Gene: ENSMUSG00000001504

DomainStartEndE-ValueType
HOX 21 86 1.14e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169028
Predicted Effect probably benign
Transcript: ENSMUST00000172353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177421
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRX2 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Irx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Irx2 APN 13 72631310 missense probably damaging 1.00
R0647:Irx2 UTSW 13 72630680 missense probably damaging 1.00
R0783:Irx2 UTSW 13 72632650 critical splice donor site probably null
R0931:Irx2 UTSW 13 72631556 missense possibly damaging 0.71
R0932:Irx2 UTSW 13 72631556 missense possibly damaging 0.71
R1782:Irx2 UTSW 13 72631466 missense probably benign 0.19
R2844:Irx2 UTSW 13 72631590 missense probably damaging 1.00
R4656:Irx2 UTSW 13 72631298 missense probably damaging 1.00
R4963:Irx2 UTSW 13 72632610 missense possibly damaging 0.71
R5219:Irx2 UTSW 13 72631301 missense probably damaging 1.00
R5523:Irx2 UTSW 13 72631595 missense probably damaging 1.00
R7311:Irx2 UTSW 13 72631277 missense probably damaging 0.98
R7411:Irx2 UTSW 13 72629063 start codon destroyed probably null 0.99
R7487:Irx2 UTSW 13 72630620 missense probably damaging 1.00
R7506:Irx2 UTSW 13 72629209 missense probably damaging 1.00
R7792:Irx2 UTSW 13 72631374 missense possibly damaging 0.88
R7953:Irx2 UTSW 13 72629224 missense probably benign 0.02
Z1177:Irx2 UTSW 13 72629089 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTCCTCACTCCTGACTGCAG -3'
(R):5'- AAGCAGTTACCACGTAGGAC -3'

Sequencing Primer
(F):5'- ACTCCTGACTGCAGACTCC -3'
(R):5'- CGTAGGACGGGAAGCCG -3'
Posted On2018-07-23