Incidental Mutation 'R6663:Lrrc14b'
ID526885
Institutional Source Beutler Lab
Gene Symbol Lrrc14b
Ensembl Gene ENSMUSG00000021579
Gene Nameleucine rich repeat containing 14B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74359578-74364005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74361361 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 309 (N309S)
Ref Sequence ENSEMBL: ENSMUSP00000022064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022063] [ENSMUST00000022064] [ENSMUST00000159931] [ENSMUST00000160021] [ENSMUST00000162376] [ENSMUST00000162672]
Predicted Effect probably benign
Transcript: ENSMUST00000022063
SMART Domains Protein: ENSMUSP00000022063
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
coiled coil region 78 140 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000022064
AA Change: N309S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022064
Gene: ENSMUSG00000021579
AA Change: N309S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 208 417 8e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159931
SMART Domains Protein: ENSMUSP00000124009
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160021
SMART Domains Protein: ENSMUSP00000124193
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162376
SMART Domains Protein: ENSMUSP00000123805
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223491
Meta Mutation Damage Score 0.2414 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Lrrc14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Lrrc14b APN 13 74360959 missense probably damaging 0.97
IGL01521:Lrrc14b APN 13 74363572 missense probably damaging 1.00
IGL03156:Lrrc14b APN 13 74363904 missense probably benign
R0457:Lrrc14b UTSW 13 74361160 missense probably benign 0.41
R1631:Lrrc14b UTSW 13 74361254 splice site probably null
R1741:Lrrc14b UTSW 13 74363586 missense probably damaging 1.00
R2042:Lrrc14b UTSW 13 74363442 missense probably benign 0.00
R2047:Lrrc14b UTSW 13 74363442 missense probably benign 0.00
R2149:Lrrc14b UTSW 13 74363757 missense possibly damaging 0.63
R3083:Lrrc14b UTSW 13 74363218 missense possibly damaging 0.63
R3838:Lrrc14b UTSW 13 74363545 missense possibly damaging 0.86
R3892:Lrrc14b UTSW 13 74363668 missense probably benign 0.00
R5748:Lrrc14b UTSW 13 74363640 missense probably damaging 1.00
R6508:Lrrc14b UTSW 13 74363218 missense possibly damaging 0.63
R6687:Lrrc14b UTSW 13 74360762 missense probably benign 0.00
R7309:Lrrc14b UTSW 13 74363202 missense probably benign 0.08
R7472:Lrrc14b UTSW 13 74363107 missense probably damaging 1.00
R7574:Lrrc14b UTSW 13 74360773 missense probably damaging 0.98
R7629:Lrrc14b UTSW 13 74361164 missense probably benign 0.03
R7695:Lrrc14b UTSW 13 74363178 missense possibly damaging 0.91
R8169:Lrrc14b UTSW 13 74363167 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GGCCCAGAATCATCATGTTAAC -3'
(R):5'- GCTAACGTGAAATGAAGTCAGC -3'

Sequencing Primer
(F):5'- CTGTGATGTTGCACTCCTCGAG -3'
(R):5'- CGTGAAATGAAGTCAGCTGGAGTTTC -3'
Posted On2018-07-23