Mutagenetix > Incidental Mutation

Incidental Mutation 'R6663:Lrrc14b'

526885

Institutional Source

Beutler Lab

Gene Symbol

Lrrc14b

Ensembl Gene

ENSMUSG00000021579

Gene Name

leucine rich repeat containing 14B

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R6663 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74359578-74364005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74361361 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 309 (N309S)

Ref Sequence

ENSEMBL: ENSMUSP00000022064 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022063] [ENSMUST00000022064] [ENSMUST00000159931] [ENSMUST00000160021] [ENSMUST00000162376] [ENSMUST00000162672]

AlphaFold

Q3UJB3

Predicted Effect

probably benign
Transcript: ENSMUST00000022063

SMART Domains

Protein: ENSMUSP00000022063
Gene: ENSMUSG00000021578

Domain	Start	End	E-Value	Type
coiled coil region	78	140	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000022064
AA Change: N309S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022064
Gene: ENSMUSG00000021579
AA Change: N309S

Domain	Start	End	E-Value	Type
SCOP:d1a4ya_	208	417	8e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159931

SMART Domains

Protein: ENSMUSP00000124009
Gene: ENSMUSG00000021578

Domain	Start	End	E-Value	Type
transmembrane domain	26	45	N/A	INTRINSIC
coiled coil region	78	140	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160021

SMART Domains

Protein: ENSMUSP00000124193
Gene: ENSMUSG00000021578

Domain	Start	End	E-Value	Type
transmembrane domain	26	45	N/A	INTRINSIC
coiled coil region	78	140	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162376

SMART Domains

Protein: ENSMUSP00000123805
Gene: ENSMUSG00000021578

Domain	Start	End	E-Value	Type
transmembrane domain	26	45	N/A	INTRINSIC
coiled coil region	78	140	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162672

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223491

Meta Mutation Damage Score

0.2414

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

100% (32/32)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd17	A	G	5: 90,264,064	S1314P	probably damaging	Het
Btbd3	T	A	2: 138,279,083	I59K	probably benign	Het
Clcn2	A	G	16: 20,703,245	*865R	probably null	Het
Col22a1	T	C	15: 71,820,059	Q749R	unknown	Het
Cpsf2	T	C	12: 101,999,593	Y606H	probably damaging	Het
Csn1s1	T	C	5: 87,675,740	V154A	probably benign	Het
Cux1	T	A	5: 136,485,847	E23V	probably damaging	Het
Cyp2j9	C	A	4: 96,579,442	W269L	probably benign	Het
Dbf4	T	C	5: 8,403,184	M273V	probably benign	Het
Dnhd1	A	G	7: 105,685,692		probably null	Het
Fezf1	A	G	6: 23,247,528	S183P	probably damaging	Het
Irx2	A	G	13: 72,629,129	Y23C	probably damaging	Het
Itga1	A	T	13: 114,974,105	N983K	probably benign	Het
Kifc1	A	G	17: 33,881,456		probably benign	Het
Lyst	A	T	13: 13,664,116		probably null	Het
Map1b	T	C	13: 99,430,022	T2064A	unknown	Het
Mark3	T	A	12: 111,575,083	N11K	probably benign	Het
Med6	T	A	12: 81,581,875	D80V	possibly damaging	Het
Mfhas1	A	G	8: 35,589,118	E249G	probably damaging	Het
Mroh2b	A	G	15: 4,947,935	I1256M	probably benign	Het
Nkx2-9	G	T	12: 56,611,938	R164S	probably benign	Het
Olfr1181	T	A	2: 88,423,350	N225I	probably benign	Het
Phf10	T	C	17: 14,959,512	D33G	probably null	Het
Plekha5	A	G	6: 140,577,290	M719V	probably damaging	Het
Pln	A	G	10: 53,343,696		probably benign	Het
Prg4	G	A	1: 150,455,101		probably benign	Het
Slc35b3	A	G	13: 38,954,136	L99P	probably damaging	Het
Tbccd1	AT	ATGT	16: 22,834,028		probably null	Het
Ube2j1	C	T	4: 33,045,198	S157L	probably damaging	Het
Zfp462	A	G	4: 55,008,933	T300A	possibly damaging	Het
Zfp668	G	A	7: 127,867,769	R212C	probably damaging	Het
Zufsp	A	G	10: 33,949,435	M17T	possibly damaging	Het

Other mutations in Lrrc14b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Lrrc14b	APN	13	74360959	missense	probably damaging	0.97
IGL01521:Lrrc14b	APN	13	74363572	missense	probably damaging	1.00
IGL03156:Lrrc14b	APN	13	74363904	missense	probably benign
R0457:Lrrc14b	UTSW	13	74361160	missense	probably benign	0.41
R1631:Lrrc14b	UTSW	13	74361254	splice site	probably null
R1741:Lrrc14b	UTSW	13	74363586	missense	probably damaging	1.00
R2042:Lrrc14b	UTSW	13	74363442	missense	probably benign	0.00
R2047:Lrrc14b	UTSW	13	74363442	missense	probably benign	0.00
R2149:Lrrc14b	UTSW	13	74363757	missense	possibly damaging	0.63
R3083:Lrrc14b	UTSW	13	74363218	missense	possibly damaging	0.63
R3838:Lrrc14b	UTSW	13	74363545	missense	possibly damaging	0.86
R3892:Lrrc14b	UTSW	13	74363668	missense	probably benign	0.00
R5748:Lrrc14b	UTSW	13	74363640	missense	probably damaging	1.00
R6508:Lrrc14b	UTSW	13	74363218	missense	possibly damaging	0.63
R6687:Lrrc14b	UTSW	13	74360762	missense	probably benign	0.00
R7309:Lrrc14b	UTSW	13	74363202	missense	probably benign	0.08
R7472:Lrrc14b	UTSW	13	74363107	missense	probably damaging	1.00
R7574:Lrrc14b	UTSW	13	74360773	missense	probably damaging	0.98
R7629:Lrrc14b	UTSW	13	74361164	missense	probably benign	0.03
R7695:Lrrc14b	UTSW	13	74363178	missense	possibly damaging	0.91
R8169:Lrrc14b	UTSW	13	74363167	missense	possibly damaging	0.56
R8824:Lrrc14b	UTSW	13	74363949	missense	probably damaging	1.00
R8852:Lrrc14b	UTSW	13	74361289	missense	probably damaging	1.00
R8860:Lrrc14b	UTSW	13	74361289	missense	probably damaging	1.00
R9010:Lrrc14b	UTSW	13	74361032	missense	possibly damaging	0.48
R9548:Lrrc14b	UTSW	13	74363877	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGCCCAGAATCATCATGTTAAC -3'
(R):5'- GCTAACGTGAAATGAAGTCAGC -3'

Sequencing Primer
(F):5'- CTGTGATGTTGCACTCCTCGAG -3'
(R):5'- CGTGAAATGAAGTCAGCTGGAGTTTC -3'

Posted On

2018-07-23