Mutagenetix > Incidental Mutations

Incidental Mutation 'R6663:Itga1'

526887

Institutional Source

Beutler Lab

Gene Symbol

Itga1

Ensembl Gene

ENSMUSG00000042284

Gene Name

integrin alpha 1

Synonyms

CD49A, Vla1, E130012M19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.319) question?

Stock #

R6663 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114953096-115101964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 114974105 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 983 (N983K)

Ref Sequence

ENSEMBL: ENSMUSP00000077132 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061673]

Predicted Effect

probably benign
Transcript: ENSMUST00000061673
AA Change: N983K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: N983K

Domain	Start	End	E-Value	Type
Int_alpha	43	96	1.63e0	SMART
VWA	170	360	4.24e-44	SMART
Int_alpha	432	481	4.21e-3	SMART
Int_alpha	485	542	3.19e-12	SMART
Int_alpha	566	621	1.79e-15	SMART
Int_alpha	628	682	3.04e1	SMART
low complexity region	1108	1122	N/A	INTRINSIC
PDB:2L8S\|A	1135	1179	5e-10	PDB

Meta Mutation Damage Score

0.1134

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd17	A	G	5: 90,264,064	S1314P	probably damaging	Het
Btbd3	T	A	2: 138,279,083	I59K	probably benign	Het
Clcn2	A	G	16: 20,703,245	*865R	probably null	Het
Col22a1	T	C	15: 71,820,059	Q749R	unknown	Het
Cpsf2	T	C	12: 101,999,593	Y606H	probably damaging	Het
Csn1s1	T	C	5: 87,675,740	V154A	probably benign	Het
Cux1	T	A	5: 136,485,847	E23V	probably damaging	Het
Cyp2j9	C	A	4: 96,579,442	W269L	probably benign	Het
Dbf4	T	C	5: 8,403,184	M273V	probably benign	Het
Dnhd1	A	G	7: 105,685,692		probably null	Het
Fezf1	A	G	6: 23,247,528	S183P	probably damaging	Het
Irx2	A	G	13: 72,629,129	Y23C	probably damaging	Het
Kifc1	A	G	17: 33,881,456		probably benign	Het
Lrrc14b	T	C	13: 74,361,361	N309S	probably damaging	Het
Lyst	A	T	13: 13,664,116		probably null	Het
Map1b	T	C	13: 99,430,022	T2064A	unknown	Het
Mark3	T	A	12: 111,575,083	N11K	probably benign	Het
Med6	T	A	12: 81,581,875	D80V	possibly damaging	Het
Mfhas1	A	G	8: 35,589,118	E249G	probably damaging	Het
Mroh2b	A	G	15: 4,947,935	I1256M	probably benign	Het
Nkx2-9	G	T	12: 56,611,938	R164S	probably benign	Het
Olfr1181	T	A	2: 88,423,350	N225I	probably benign	Het
Phf10	T	C	17: 14,959,512	D33G	probably null	Het
Plekha5	A	G	6: 140,577,290	M719V	probably damaging	Het
Pln	A	G	10: 53,343,696		probably benign	Het
Prg4	G	A	1: 150,455,101		probably benign	Het
Slc35b3	A	G	13: 38,954,136	L99P	probably damaging	Het
Tbccd1	AT	ATGT	16: 22,834,028		probably null	Het
Ube2j1	C	T	4: 33,045,198	S157L	probably damaging	Het
Zfp462	A	G	4: 55,008,933	T300A	possibly damaging	Het
Zfp668	G	A	7: 127,867,769	R212C	probably damaging	Het
Zufsp	A	G	10: 33,949,435	M17T	possibly damaging	Het

Other mutations in Itga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Itga1	APN	13	114992363	missense	possibly damaging	0.80
IGL00498:Itga1	APN	13	115031193	missense	probably benign	0.00
IGL00549:Itga1	APN	13	115049296	missense	possibly damaging	0.92
IGL00587:Itga1	APN	13	115012249	missense	probably damaging	1.00
IGL01021:Itga1	APN	13	114997000	missense	probably benign	0.29
IGL01289:Itga1	APN	13	114986226	missense	possibly damaging	0.79
IGL01636:Itga1	APN	13	115006948	missense	possibly damaging	0.73
IGL01791:Itga1	APN	13	114987661	missense	probably benign	0.00
IGL01796:Itga1	APN	13	114985121	missense	probably damaging	1.00
IGL02027:Itga1	APN	13	114990055	splice site	probably null
IGL02330:Itga1	APN	13	115012204	missense	probably damaging	1.00
IGL02480:Itga1	APN	13	114987648	missense	probably damaging	1.00
IGL02943:Itga1	APN	13	115049296	missense	possibly damaging	0.92
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0244:Itga1	UTSW	13	115006897	splice site	probably benign
R0265:Itga1	UTSW	13	114992459	missense	probably benign
R0302:Itga1	UTSW	13	115012318	splice site	probably benign
R0320:Itga1	UTSW	13	114977594	splice site	probably benign
R0389:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0443:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0574:Itga1	UTSW	13	114966561	missense	probably damaging	1.00
R0646:Itga1	UTSW	13	114968299	missense	probably benign
R0830:Itga1	UTSW	13	115007032	missense	probably benign	0.08
R2162:Itga1	UTSW	13	115030910	missense	probably benign	0.23
R2216:Itga1	UTSW	13	114997029	missense	probably benign	0.00
R2403:Itga1	UTSW	13	114977614	missense	probably benign	0.00
R3734:Itga1	UTSW	13	114977639	missense	probably benign
R4171:Itga1	UTSW	13	115030886	nonsense	probably null
R4402:Itga1	UTSW	13	115001566	missense	probably benign	0.00
R4675:Itga1	UTSW	13	115001691	splice site	probably null
R4684:Itga1	UTSW	13	115049370	missense	probably damaging	1.00
R4795:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4796:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4845:Itga1	UTSW	13	114974172	nonsense	probably null
R5147:Itga1	UTSW	13	114985142	missense	possibly damaging	0.91
R5155:Itga1	UTSW	13	115035303	missense	probably benign
R5234:Itga1	UTSW	13	115049303	nonsense	probably null
R5344:Itga1	UTSW	13	115002309	missense	possibly damaging	0.78
R5554:Itga1	UTSW	13	114992474	nonsense	probably null
R5662:Itga1	UTSW	13	114986171	missense	probably benign	0.03
R5945:Itga1	UTSW	13	114966590	missense	probably benign	0.02
R6150:Itga1	UTSW	13	114968233	missense	probably benign	0.01
R6241:Itga1	UTSW	13	114960137	splice site	probably null
R6276:Itga1	UTSW	13	114980852	missense	probably benign
R6369:Itga1	UTSW	13	114965660	missense	probably damaging	1.00
R6511:Itga1	UTSW	13	114992501	missense	probably damaging	0.98
R6783:Itga1	UTSW	13	114996977	missense	probably benign	0.22
R6931:Itga1	UTSW	13	115001563	missense	probably benign	0.39
R7069:Itga1	UTSW	13	114968240	missense	probably damaging	1.00
R7458:Itga1	UTSW	13	114986266	missense	probably benign	0.00
R7588:Itga1	UTSW	13	114968249	missense	possibly damaging	0.88
R7591:Itga1	UTSW	13	114982779	missense	probably damaging	1.00
R7597:Itga1	UTSW	13	114974140	missense	probably benign	0.28
R7615:Itga1	UTSW	13	114996922	missense	probably null	0.99
R7756:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R7795:Itga1	UTSW	13	115012236	missense	probably damaging	1.00
R7819:Itga1	UTSW	13	115049301	missense	probably damaging	0.99
R8193:Itga1	UTSW	13	114968455	critical splice donor site	probably null
R8313:Itga1	UTSW	13	114966584	missense	probably benign	0.06
R8419:Itga1	UTSW	13	115007068	missense	probably damaging	1.00
Z1177:Itga1	UTSW	13	114985071	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CACTTAATCTTAGCCTGAAGGTCTAG -3'
(R):5'- GGGGTGTAAAAGAATCACTCTCTG -3'

Sequencing Primer
(F):5'- ATCTTAGCCTGAAGGTCTAGAAGTG -3'
(R):5'- GAATCACTCTCTGTTTTGAAGTCTAC -3'

Posted On

2018-07-23