Mutagenetix > Incidental Mutations

Incidental Mutation 'R6663:Col22a1'

526889

Institutional Source

Beutler Lab

Gene Symbol

Col22a1

Ensembl Gene

ENSMUSG00000079022

Gene Name

collagen, type XXII, alpha 1

Synonyms

C80743, 2310067L16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6663 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71795795-72034227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71820059 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 749 (Q749R)

Ref Sequence

ENSEMBL: ENSMUSP00000155641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159993] [ENSMUST00000229585]

Predicted Effect

unknown
Transcript: ENSMUST00000159993
AA Change: Q1304R

SMART Domains

Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: Q1304R

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
VWA	45	227	1.35e-51	SMART
TSPN	248	436	1.26e-33	SMART
low complexity region	454	470	N/A	INTRINSIC
internal_repeat_3	494	555	1.96e-13	PROSPERO
internal_repeat_1	496	643	1.49e-19	PROSPERO
low complexity region	644	657	N/A	INTRINSIC
low complexity region	673	707	N/A	INTRINSIC
Pfam:Collagen	751	823	1.5e-9	PFAM
Pfam:Collagen	810	863	2.3e-10	PFAM
Pfam:Collagen	869	931	4.8e-11	PFAM
Pfam:Collagen	926	990	1.1e-10	PFAM
Pfam:Collagen	1031	1087	1.7e-10	PFAM
Pfam:Collagen	1104	1162	1.8e-11	PFAM
low complexity region	1173	1227	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
internal_repeat_2	1257	1348	3.25e-18	PROSPERO
internal_repeat_4	1268	1347	9.67e-7	PROSPERO
Pfam:Collagen	1389	1448	4e-10	PFAM
Pfam:Collagen	1481	1540	2.6e-9	PFAM
low complexity region	1546	1558	N/A	INTRINSIC
low complexity region	1580	1590	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000229585
AA Change: Q749R

Meta Mutation Damage Score

0.0840

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd17	A	G	5: 90,264,064	S1314P	probably damaging	Het
Btbd3	T	A	2: 138,279,083	I59K	probably benign	Het
Clcn2	A	G	16: 20,703,245	*865R	probably null	Het
Cpsf2	T	C	12: 101,999,593	Y606H	probably damaging	Het
Csn1s1	T	C	5: 87,675,740	V154A	probably benign	Het
Cux1	T	A	5: 136,485,847	E23V	probably damaging	Het
Cyp2j9	C	A	4: 96,579,442	W269L	probably benign	Het
Dbf4	T	C	5: 8,403,184	M273V	probably benign	Het
Dnhd1	A	G	7: 105,685,692		probably null	Het
Fezf1	A	G	6: 23,247,528	S183P	probably damaging	Het
Irx2	A	G	13: 72,629,129	Y23C	probably damaging	Het
Itga1	A	T	13: 114,974,105	N983K	probably benign	Het
Kifc1	A	G	17: 33,881,456		probably benign	Het
Lrrc14b	T	C	13: 74,361,361	N309S	probably damaging	Het
Lyst	A	T	13: 13,664,116		probably null	Het
Map1b	T	C	13: 99,430,022	T2064A	unknown	Het
Mark3	T	A	12: 111,575,083	N11K	probably benign	Het
Med6	T	A	12: 81,581,875	D80V	possibly damaging	Het
Mfhas1	A	G	8: 35,589,118	E249G	probably damaging	Het
Mroh2b	A	G	15: 4,947,935	I1256M	probably benign	Het
Nkx2-9	G	T	12: 56,611,938	R164S	probably benign	Het
Olfr1181	T	A	2: 88,423,350	N225I	probably benign	Het
Phf10	T	C	17: 14,959,512	D33G	probably null	Het
Plekha5	A	G	6: 140,577,290	M719V	probably damaging	Het
Pln	A	G	10: 53,343,696		probably benign	Het
Prg4	G	A	1: 150,455,101		probably benign	Het
Slc35b3	A	G	13: 38,954,136	L99P	probably damaging	Het
Tbccd1	AT	ATGT	16: 22,834,028		probably null	Het
Ube2j1	C	T	4: 33,045,198	S157L	probably damaging	Het
Zfp462	A	G	4: 55,008,933	T300A	possibly damaging	Het
Zfp668	G	A	7: 127,867,769	R212C	probably damaging	Het
Zufsp	A	G	10: 33,949,435	M17T	possibly damaging	Het

Other mutations in Col22a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Col22a1	APN	15	71860958	critical splice donor site	probably null
IGL00434:Col22a1	APN	15	72006675	missense	possibly damaging	0.71
IGL00721:Col22a1	APN	15	71846177	missense	unknown
IGL00902:Col22a1	APN	15	71964659	missense	probably damaging	1.00
IGL01311:Col22a1	APN	15	71973637	splice site	probably benign
IGL01329:Col22a1	APN	15	71907040	missense	probably benign	0.02
IGL01527:Col22a1	APN	15	71907031	missense	probably damaging	0.98
IGL01870:Col22a1	APN	15	71952528	missense	probably benign	0.07
IGL02002:Col22a1	APN	15	71811097	splice site	probably benign
IGL02248:Col22a1	APN	15	71799448	missense	unknown
IGL02322:Col22a1	APN	15	71822653	missense	unknown
IGL02472:Col22a1	APN	15	71827753	splice site	probably benign
IGL02685:Col22a1	APN	15	71801915	missense	unknown
IGL02888:Col22a1	APN	15	71846219	missense	unknown
IGL02971:Col22a1	APN	15	72006738	missense	probably damaging	1.00
IGL03175:Col22a1	APN	15	71969103	missense	possibly damaging	0.81
IGL03240:Col22a1	APN	15	71807928	missense	unknown
R0083:Col22a1	UTSW	15	71890497	missense	possibly damaging	0.70
R0383:Col22a1	UTSW	15	71869004	missense	unknown
R0449:Col22a1	UTSW	15	71962671	critical splice donor site	probably null
R0508:Col22a1	UTSW	15	71933413	missense	unknown
R0944:Col22a1	UTSW	15	71881662	missense	probably benign	0.03
R1289:Col22a1	UTSW	15	71837377	missense	unknown
R1436:Col22a1	UTSW	15	71922957	splice site	probably benign
R1439:Col22a1	UTSW	15	71952377	splice site	probably benign
R1460:Col22a1	UTSW	15	71821931	missense	unknown
R1680:Col22a1	UTSW	15	71799361	missense	unknown
R1715:Col22a1	UTSW	15	72006981	missense	possibly damaging	0.79
R1742:Col22a1	UTSW	15	71801913	missense	unknown
R1745:Col22a1	UTSW	15	72006787	missense	probably damaging	1.00
R1763:Col22a1	UTSW	15	72007176	missense	probably damaging	0.96
R1932:Col22a1	UTSW	15	71870140	missense	unknown
R2125:Col22a1	UTSW	15	71848577	missense	unknown
R2126:Col22a1	UTSW	15	71857253	nonsense	probably null
R2137:Col22a1	UTSW	15	72006948	missense	possibly damaging	0.46
R2860:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2861:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2862:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R3704:Col22a1	UTSW	15	71970307	missense	probably damaging	1.00
R3778:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R3940:Col22a1	UTSW	15	71981933	nonsense	probably null
R3950:Col22a1	UTSW	15	71977358	missense	possibly damaging	0.90
R4240:Col22a1	UTSW	15	72007131	missense	probably damaging	1.00
R4531:Col22a1	UTSW	15	72007149	missense	probably damaging	1.00
R4597:Col22a1	UTSW	15	71964662	missense	possibly damaging	0.83
R4604:Col22a1	UTSW	15	71952339	missense	probably benign	0.36
R4654:Col22a1	UTSW	15	71973695	missense	possibly damaging	0.95
R4782:Col22a1	UTSW	15	71801925	missense	unknown
R4847:Col22a1	UTSW	15	71799499	missense	unknown
R4980:Col22a1	UTSW	15	71801943	missense	unknown
R4981:Col22a1	UTSW	15	71861066	missense	unknown
R4996:Col22a1	UTSW	15	72007161	missense	probably damaging	0.99
R5007:Col22a1	UTSW	15	71944422	missense	probably damaging	1.00
R5135:Col22a1	UTSW	15	71799337	missense	unknown
R5197:Col22a1	UTSW	15	72009406	missense	probably damaging	0.96
R5292:Col22a1	UTSW	15	71970336	missense	probably damaging	1.00
R5449:Col22a1	UTSW	15	71821949	missense	unknown
R5480:Col22a1	UTSW	15	71964611	missense	probably damaging	0.98
R5627:Col22a1	UTSW	15	71981918	missense	probably damaging	0.98
R5828:Col22a1	UTSW	15	72009491	missense	probably benign	0.01
R5927:Col22a1	UTSW	15	72006966	missense	probably damaging	1.00
R6006:Col22a1	UTSW	15	71973836	missense	probably damaging	1.00
R6245:Col22a1	UTSW	15	71973816	missense	probably damaging	0.99
R6288:Col22a1	UTSW	15	71894869	critical splice acceptor site	probably null
R6482:Col22a1	UTSW	15	71890489	missense	possibly damaging	0.93
R6497:Col22a1	UTSW	15	71890576	missense	possibly damaging	0.85
R6579:Col22a1	UTSW	15	71881653	missense	probably benign	0.18
R6643:Col22a1	UTSW	15	71822037	splice site	probably null
R7179:Col22a1	UTSW	15	71933413	missense	unknown
R7215:Col22a1	UTSW	15	71970332	nonsense	probably null
R7216:Col22a1	UTSW	15	71973845	missense	probably damaging	1.00
R7505:Col22a1	UTSW	15	71799399	nonsense	probably null
R7585:Col22a1	UTSW	15	71892205	missense	probably damaging	0.99
R7699:Col22a1	UTSW	15	71973851	missense	probably damaging	1.00
R7788:Col22a1	UTSW	15	71952317	critical splice donor site	probably null
R7921:Col22a1	UTSW	15	71981962	splice site	probably null
R8205:Col22a1	UTSW	15	71861069	missense	unknown
X0066:Col22a1	UTSW	15	71801879	missense	unknown
X0066:Col22a1	UTSW	15	71846200	missense	unknown
Y5406:Col22a1	UTSW	15	71799515	missense	unknown
Z1177:Col22a1	UTSW	15	71915120	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GTGGGTAGACTGTCAGTAAGTC -3'
(R):5'- ATGCAAGTTAAGAGTCCTTGGC -3'

Sequencing Primer
(F):5'- GCCCTGGGGTACATATAAGACATTC -3'
(R):5'- GTCCTTGGCATTCAAAAGGAAC -3'

Posted On

2018-07-23