Incidental Mutation 'R6663:Clcn2'
ID526890
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Namechloride channel, voltage-sensitive 2
SynonymsClC-2, nmf240, Clc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20702964-20717746 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 20703245 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 865 (*865R)
Ref Sequence ENSEMBL: ENSMUSP00000155857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000056518] [ENSMUST00000118919] [ENSMUST00000120099] [ENSMUST00000128273] [ENSMUST00000131522] [ENSMUST00000149543] [ENSMUST00000232207] [ENSMUST00000232309]
Predicted Effect probably null
Transcript: ENSMUST00000007207
AA Change: *909R
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: *909R

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056518
SMART Domains Protein: ENSMUSP00000060194
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
low complexity region 45 60 N/A INTRINSIC
Pfam:FAM131 80 356 6.4e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118919
SMART Domains Protein: ENSMUSP00000113719
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 271 4e-119 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120099
AA Change: *892R
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: *892R

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123417
Predicted Effect probably benign
Transcript: ENSMUST00000128273
SMART Domains Protein: ENSMUSP00000120596
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 202 4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131522
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148131
Predicted Effect probably benign
Transcript: ENSMUST00000149543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153075
Predicted Effect probably benign
Transcript: ENSMUST00000232207
Predicted Effect probably null
Transcript: ENSMUST00000232309
AA Change: *865R
Meta Mutation Damage Score 0.8665 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20703641 missense probably benign 0.08
IGL01657:Clcn2 APN 16 20713619 missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20712761 missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20708464 missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20703348 missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20709256 nonsense probably null
IGL03329:Clcn2 APN 16 20712152 missense probably damaging 1.00
Bemr14 UTSW 16 unclassified
R0008:Clcn2 UTSW 16 20710390 missense probably null 1.00
R0454:Clcn2 UTSW 16 20710428 critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20703595 missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20712552 splice site probably benign
R1824:Clcn2 UTSW 16 20715962 missense probably benign 0.04
R4592:Clcn2 UTSW 16 20709142 missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20703303 missense probably benign 0.01
R5374:Clcn2 UTSW 16 20709669 missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20710535 intron probably benign
R5787:Clcn2 UTSW 16 20703433 missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20713654 missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20711688 critical splice donor site probably null
R6765:Clcn2 UTSW 16 20707668 splice site probably null
R6825:Clcn2 UTSW 16 20709658 utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20708460 missense probably damaging 0.99
R8028:Clcn2 UTSW 16 20708762 missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20707196 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAACCCAGTTTAGTTCTGCCC -3'
(R):5'- AGGAGTCTGAGGCACACATCTG -3'

Sequencing Primer
(F):5'- CCCTTTTCTCAAAGATGGGGCAG -3'
(R):5'- CATTGAAGGCTCTGTCACAGC -3'
Posted On2018-07-23