Mutagenetix > Incidental Mutations

Incidental Mutation 'R6663:Clcn2'

526890

Institutional Source

Beutler Lab

Gene Symbol

Clcn2

Ensembl Gene

ENSMUSG00000022843

Gene Name

chloride channel, voltage-sensitive 2

Synonyms

ClC-2, nmf240, Clc2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R6663 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20702964-20717746 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 20703245 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Arginine at position 865 (*865R)

Ref Sequence

ENSEMBL: ENSMUSP00000155857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000056518] [ENSMUST00000118919] [ENSMUST00000120099] [ENSMUST00000128273] [ENSMUST00000131522] [ENSMUST00000149543] [ENSMUST00000232207] [ENSMUST00000232309]

Predicted Effect

probably null
Transcript: ENSMUST00000007207
AA Change: *909R

SMART Domains

Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: *909R

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	102	111	N/A	INTRINSIC
Pfam:Voltage_CLC	151	555	1.2e-94	PFAM
Blast:CBS	595	644	3e-12	BLAST
low complexity region	666	680	N/A	INTRINSIC
CBS	803	850	3.69e0	SMART
low complexity region	869	881	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000056518

SMART Domains

Protein: ENSMUSP00000060194
Gene: ENSMUSG00000050821

Domain	Start	End	E-Value	Type
low complexity region	45	60	N/A	INTRINSIC
Pfam:FAM131	80	356	6.4e-144	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118919

SMART Domains

Protein: ENSMUSP00000113719
Gene: ENSMUSG00000050821

Domain	Start	End	E-Value	Type
Pfam:FAM131	1	271	4e-119	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000120099
AA Change: *892R

SMART Domains

Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: *892R

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	102	111	N/A	INTRINSIC
Pfam:Voltage_CLC	151	538	5.6e-77	PFAM
Blast:CBS	578	627	4e-12	BLAST
low complexity region	649	663	N/A	INTRINSIC
CBS	786	833	3.69e0	SMART
low complexity region	852	864	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123417

Predicted Effect

probably benign
Transcript: ENSMUST00000128273

SMART Domains

Protein: ENSMUSP00000120596
Gene: ENSMUSG00000050821

Domain	Start	End	E-Value	Type
Pfam:FAM131	1	202	4e-100	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131522

SMART Domains

Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	102	111	N/A	INTRINSIC
Pfam:Voltage_CLC	151	473	4.2e-63	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144400

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148131

Predicted Effect

probably benign
Transcript: ENSMUST00000149543

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153075

Predicted Effect

probably benign
Transcript: ENSMUST00000232207

Predicted Effect

probably null
Transcript: ENSMUST00000232309
AA Change: *865R

Meta Mutation Damage Score

0.8665

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd17	A	G	5: 90,264,064	S1314P	probably damaging	Het
Btbd3	T	A	2: 138,279,083	I59K	probably benign	Het
Col22a1	T	C	15: 71,820,059	Q749R	unknown	Het
Cpsf2	T	C	12: 101,999,593	Y606H	probably damaging	Het
Csn1s1	T	C	5: 87,675,740	V154A	probably benign	Het
Cux1	T	A	5: 136,485,847	E23V	probably damaging	Het
Cyp2j9	C	A	4: 96,579,442	W269L	probably benign	Het
Dbf4	T	C	5: 8,403,184	M273V	probably benign	Het
Dnhd1	A	G	7: 105,685,692		probably null	Het
Fezf1	A	G	6: 23,247,528	S183P	probably damaging	Het
Irx2	A	G	13: 72,629,129	Y23C	probably damaging	Het
Itga1	A	T	13: 114,974,105	N983K	probably benign	Het
Kifc1	A	G	17: 33,881,456		probably benign	Het
Lrrc14b	T	C	13: 74,361,361	N309S	probably damaging	Het
Lyst	A	T	13: 13,664,116		probably null	Het
Map1b	T	C	13: 99,430,022	T2064A	unknown	Het
Mark3	T	A	12: 111,575,083	N11K	probably benign	Het
Med6	T	A	12: 81,581,875	D80V	possibly damaging	Het
Mfhas1	A	G	8: 35,589,118	E249G	probably damaging	Het
Mroh2b	A	G	15: 4,947,935	I1256M	probably benign	Het
Nkx2-9	G	T	12: 56,611,938	R164S	probably benign	Het
Olfr1181	T	A	2: 88,423,350	N225I	probably benign	Het
Phf10	T	C	17: 14,959,512	D33G	probably null	Het
Plekha5	A	G	6: 140,577,290	M719V	probably damaging	Het
Pln	A	G	10: 53,343,696		probably benign	Het
Prg4	G	A	1: 150,455,101		probably benign	Het
Slc35b3	A	G	13: 38,954,136	L99P	probably damaging	Het
Tbccd1	AT	ATGT	16: 22,834,028		probably null	Het
Ube2j1	C	T	4: 33,045,198	S157L	probably damaging	Het
Zfp462	A	G	4: 55,008,933	T300A	possibly damaging	Het
Zfp668	G	A	7: 127,867,769	R212C	probably damaging	Het
Zufsp	A	G	10: 33,949,435	M17T	possibly damaging	Het

Other mutations in Clcn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00843:Clcn2	APN	16	20703641	missense	probably benign	0.08
IGL01657:Clcn2	APN	16	20713619	missense	probably damaging	1.00
IGL01797:Clcn2	APN	16	20712761	missense	probably damaging	1.00
IGL02557:Clcn2	APN	16	20708464	missense	probably damaging	1.00
IGL02624:Clcn2	APN	16	20703348	missense	probably damaging	0.98
IGL02819:Clcn2	APN	16	20709256	nonsense	probably null
IGL03329:Clcn2	APN	16	20712152	missense	probably damaging	1.00
Bemr14	UTSW	16		unclassified
R0008:Clcn2	UTSW	16	20710390	missense	probably null	1.00
R0454:Clcn2	UTSW	16	20710428	critical splice acceptor site	probably null
R1101:Clcn2	UTSW	16	20703595	missense	probably damaging	1.00
R1466:Clcn2	UTSW	16	20712552	splice site	probably benign
R1824:Clcn2	UTSW	16	20715962	missense	probably benign	0.04
R4592:Clcn2	UTSW	16	20709142	missense	probably damaging	0.99
R5011:Clcn2	UTSW	16	20707215	missense	probably damaging	1.00
R5013:Clcn2	UTSW	16	20707215	missense	probably damaging	1.00
R5154:Clcn2	UTSW	16	20703303	missense	probably benign	0.01
R5374:Clcn2	UTSW	16	20709669	missense	possibly damaging	0.78
R5726:Clcn2	UTSW	16	20710535	intron	probably benign
R5787:Clcn2	UTSW	16	20703433	missense	probably damaging	1.00
R5992:Clcn2	UTSW	16	20713654	missense	possibly damaging	0.68
R6045:Clcn2	UTSW	16	20711688	critical splice donor site	probably null
R6765:Clcn2	UTSW	16	20707668	splice site	probably null
R6825:Clcn2	UTSW	16	20709658	utr 3 prime	probably benign
R7872:Clcn2	UTSW	16	20708460	missense	probably damaging	0.99
R8028:Clcn2	UTSW	16	20708762	missense	possibly damaging	0.66
R8198:Clcn2	UTSW	16	20707196	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAAACCCAGTTTAGTTCTGCCC -3'
(R):5'- AGGAGTCTGAGGCACACATCTG -3'

Sequencing Primer
(F):5'- CCCTTTTCTCAAAGATGGGGCAG -3'
(R):5'- CATTGAAGGCTCTGTCACAGC -3'

Posted On

2018-07-23