Incidental Mutation 'R6663:Tbccd1'
ID526891
Institutional Source Beutler Lab
Gene Symbol Tbccd1
Ensembl Gene ENSMUSG00000004462
Gene NameTBCC domain containing 1
Synonyms5730478M09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6663 (G1)
Quality Score217.468
Status Validated
Chromosome16
Chromosomal Location22813214-22857669 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AT to ATGT at 22834028 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004576] [ENSMUST00000232075] [ENSMUST00000232251] [ENSMUST00000232345]
Predicted Effect probably null
Transcript: ENSMUST00000004576
SMART Domains Protein: ENSMUSP00000004576
Gene: ENSMUSG00000004462

DomainStartEndE-ValueType
low complexity region 118 129 N/A INTRINSIC
low complexity region 144 160 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
CARP 337 374 5.55e-5 SMART
CARP 375 409 8.75e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232009
Predicted Effect probably null
Transcript: ENSMUST00000232075
Predicted Effect probably null
Transcript: ENSMUST00000232251
Predicted Effect probably null
Transcript: ENSMUST00000232345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232681
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Tbccd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Tbccd1 APN 16 22822544 missense possibly damaging 0.81
PIT4243001:Tbccd1 UTSW 16 22822337 missense probably damaging 1.00
PIT4402001:Tbccd1 UTSW 16 22822123 missense probably damaging 1.00
R0055:Tbccd1 UTSW 16 22841905 missense probably damaging 1.00
R0092:Tbccd1 UTSW 16 22826094 missense possibly damaging 0.84
R0894:Tbccd1 UTSW 16 22822245 missense probably benign 0.27
R1183:Tbccd1 UTSW 16 22841769 missense probably benign 0.01
R1795:Tbccd1 UTSW 16 22822245 missense probably benign 0.27
R1813:Tbccd1 UTSW 16 22822521 missense probably benign
R2049:Tbccd1 UTSW 16 22818541 splice site probably null
R2131:Tbccd1 UTSW 16 22841989 missense probably benign 0.00
R3964:Tbccd1 UTSW 16 22841773 missense probably damaging 1.00
R4201:Tbccd1 UTSW 16 22825948 missense probably damaging 0.96
R4602:Tbccd1 UTSW 16 22818535 splice site probably null
R4921:Tbccd1 UTSW 16 22841899 missense probably benign 0.02
R6493:Tbccd1 UTSW 16 22822466 missense probably damaging 1.00
R6554:Tbccd1 UTSW 16 22822124 missense probably damaging 0.99
R7220:Tbccd1 UTSW 16 22833997 missense probably benign 0.21
R7431:Tbccd1 UTSW 16 22825813 missense probably benign 0.03
R8090:Tbccd1 UTSW 16 22842055 missense probably benign 0.00
R8186:Tbccd1 UTSW 16 22818439 missense probably damaging 1.00
R8315:Tbccd1 UTSW 16 22822814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACTCATTGTGTTTGACAGGTTG -3'
(R):5'- TGGTTTCCAGAAGTGACTCCAG -3'

Sequencing Primer
(F):5'- AGCATGCTCTACAATGCCTGG -3'
(R):5'- CCAGAAGTGACTCCAGTTATGTAG -3'
Posted On2018-07-23