Incidental Mutation 'R6663:Phf10'
ID526892
Institutional Source Beutler Lab
Gene Symbol Phf10
Ensembl Gene ENSMUSG00000023883
Gene NamePHD finger protein 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location14945009-14961273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14959512 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 33 (D33G)
Ref Sequence ENSEMBL: ENSMUSP00000024657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024657] [ENSMUST00000097399] [ENSMUST00000168938] [ENSMUST00000231584] [ENSMUST00000232173]
Predicted Effect probably null
Transcript: ENSMUST00000024657
AA Change: D33G

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000024657
Gene: ENSMUSG00000023883
AA Change: D33G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
low complexity region 281 310 N/A INTRINSIC
PHD 378 433 1.22e-8 SMART
PHD 434 478 2.44e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000097399
SMART Domains Protein: ENSMUSP00000095011
Gene: ENSMUSG00000116780

DomainStartEndE-ValueType
Pfam:Tctex-1 93 189 7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167805
Predicted Effect probably benign
Transcript: ENSMUST00000168938
AA Change: D33G

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125917
Gene: ENSMUSG00000023883
AA Change: D33G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174163
Predicted Effect probably null
Transcript: ENSMUST00000231584
Predicted Effect probably null
Transcript: ENSMUST00000232173
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains a predicted ORF that encodes a protein with two zinc finger domains. The function of the encoded protein is not known. Sequence analysis suggests that multiple alternatively spliced transcript variants are derived from this gene but the full-length nature of only two of them is known. These two splice variants encode different isoforms. A pseudogene for this gene is located on Xq28. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Phf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Phf10 APN 17 14945134 missense probably benign 0.01
IGL01752:Phf10 APN 17 14954950 splice site probably benign
IGL02048:Phf10 APN 17 14945149 missense probably benign 0.00
IGL02334:Phf10 APN 17 14954099 missense probably damaging 0.99
IGL03177:Phf10 APN 17 14946231 missense probably damaging 1.00
R1562:Phf10 UTSW 17 14946250 missense probably damaging 1.00
R1913:Phf10 UTSW 17 14956809 missense probably benign 0.00
R2159:Phf10 UTSW 17 14952664 missense probably damaging 0.99
R4468:Phf10 UTSW 17 14952775 critical splice acceptor site probably null
R4498:Phf10 UTSW 17 14945115 missense probably benign 0.17
R5357:Phf10 UTSW 17 14954013 critical splice donor site probably null
R5865:Phf10 UTSW 17 14955010 intron probably benign
R6105:Phf10 UTSW 17 14954125 critical splice acceptor site probably null
R6522:Phf10 UTSW 17 14956007 missense probably damaging 1.00
R7203:Phf10 UTSW 17 14946313 missense probably damaging 1.00
R8018:Phf10 UTSW 17 14954116 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ATAACTGTTTCTGCTGCCTGG -3'
(R):5'- TCCCAGCTCAAATAGGAAGGC -3'

Sequencing Primer
(F):5'- ATAACTGTTTCTGCTGCCTGGAATAG -3'
(R):5'- AGCTCAAATAGGAAGGCTTGCTTTG -3'
Posted On2018-07-23