Incidental Mutation 'R6663:Kifc1'
ID526893
Institutional Source Beutler Lab
Gene Symbol Kifc1
Ensembl Gene ENSMUSG00000079553
Gene Namekinesin family member C1
Synonymskinesin family c-terminal 5A, Knsl2a, Tctex-7, KNSL2, Kifc5a, Gm4137, Tctex7a, Tctex7, HSET, Tctex-7A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33875666-33890661 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 33881456 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114361] [ENSMUST00000173386] [ENSMUST00000173492]
Predicted Effect silent
Transcript: ENSMUST00000114361
SMART Domains Protein: ENSMUSP00000110001
Gene: ENSMUSG00000079553

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
Blast:KISc 82 155 2e-12 BLAST
low complexity region 156 179 N/A INTRINSIC
KISc 246 609 1.77e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172608
Predicted Effect probably benign
Transcript: ENSMUST00000173386
SMART Domains Protein: ENSMUSP00000133758
Gene: ENSMUSG00000079553

DomainStartEndE-ValueType
Blast:KISc 67 204 4e-31 BLAST
low complexity region 206 218 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000173492
SMART Domains Protein: ENSMUSP00000134572
Gene: ENSMUSG00000079553

DomainStartEndE-ValueType
low complexity region 108 119 N/A INTRINSIC
low complexity region 224 242 N/A INTRINSIC
KISc 309 672 1.77e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173885
Predicted Effect unknown
Transcript: ENSMUST00000173982
AA Change: S59P
SMART Domains Protein: ENSMUSP00000133520
Gene: ENSMUSG00000079553
AA Change: S59P

DomainStartEndE-ValueType
Blast:KISc 2 44 8e-22 BLAST
PDB:2REP|A 2 51 6e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174507
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Kifc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02707:Kifc1 APN 17 33881493 nonsense probably null
R0540:Kifc1 UTSW 17 33886647 missense probably damaging 0.98
R0607:Kifc1 UTSW 17 33886647 missense probably damaging 0.98
R1019:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1218:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1219:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1222:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1374:Kifc1 UTSW 17 33883875 missense probably benign 0.12
R1523:Kifc1 UTSW 17 33883662 missense probably benign 0.23
R1818:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1958:Kifc1 UTSW 17 33884711 missense probably benign 0.02
R1960:Kifc1 UTSW 17 33884587 critical splice donor site probably null
R5439:Kifc1 UTSW 17 33886665 missense probably damaging 1.00
R5941:Kifc1 UTSW 17 33883085 splice site probably benign
R6643:Kifc1 UTSW 17 33885855 missense probably benign 0.23
R6724:Kifc1 UTSW 17 33886733 splice site probably null
R7033:Kifc1 UTSW 17 33883697 missense probably damaging 1.00
R7498:Kifc1 UTSW 17 33883872 missense probably benign
R7515:Kifc1 UTSW 17 33884803 missense probably damaging 1.00
R7733:Kifc1 UTSW 17 33883569 missense probably damaging 1.00
R7803:Kifc1 UTSW 17 33884740 missense probably benign
R7947:Kifc1 UTSW 17 33883875 missense probably benign 0.12
R8024:Kifc1 UTSW 17 33883203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGATGGAGATGCTGCAGTG -3'
(R):5'- TTTTAAAAGGAAGGACTGTAGGACTAC -3'

Sequencing Primer
(F):5'- GTGTATTGAATACTCAGGCCCCAG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2018-07-23