Incidental Mutation 'R6664:Olfr340'
ID526894
Institutional Source Beutler Lab
Gene Symbol Olfr340
Ensembl Gene ENSMUSG00000094266
Gene Nameolfactory receptor 340
SynonymsGA_x6K02T2NLDC-33147742-33148680, MOR136-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6664 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location36452587-36453525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36453098 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 171 (N171S)
Ref Sequence ENSEMBL: ENSMUSP00000072632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072854]
Predicted Effect probably benign
Transcript: ENSMUST00000072854
AA Change: N171S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072632
Gene: ENSMUSG00000094266
AA Change: N171S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.8e-6 PFAM
Pfam:7tm_1 41 290 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU040320 A T 4: 126,835,650 Y535F probably damaging Het
Auh G C 13: 52,898,667 S138W probably damaging Het
Bmp2k A T 5: 97,088,130 K1137N probably benign Het
Btn1a1 A G 13: 23,459,320 Y320H probably benign Het
Ccdc18 C T 5: 108,168,100 Q479* probably null Het
Cyp4f18 A T 8: 71,989,915 S399T probably benign Het
Dcaf13 T C 15: 39,118,888 L83P probably damaging Het
Fbxo45 T C 16: 32,238,416 N220S probably damaging Het
Fbxw16 T C 9: 109,438,258 M302V probably benign Het
Fgb A T 3: 83,046,759 S57R probably damaging Het
Fryl A G 5: 73,132,481 V134A probably damaging Het
Gatad2a A G 8: 69,917,489 L189P probably damaging Het
Gm438 T C 4: 144,777,399 *394W probably null Het
Ifitm7 T C 16: 13,983,749 T49A probably benign Het
Itih1 T C 14: 30,933,436 T601A probably damaging Het
Jmjd4 T C 11: 59,450,419 F59L probably benign Het
Magi2 C T 5: 20,702,397 S1323L probably benign Het
Map3k21 A G 8: 125,941,871 E732G probably benign Het
Nr4a3 G A 4: 48,056,006 R344Q probably damaging Het
Olfr678 T A 7: 105,070,188 S240R possibly damaging Het
Pik3cb T C 9: 99,094,538 T169A possibly damaging Het
Prl3a1 C A 13: 27,270,211 Y57* probably null Het
Ripor2 A T 13: 24,675,820 I164F probably damaging Het
Sik2 T C 9: 50,935,457 E146G probably damaging Het
Szt2 G A 4: 118,391,745 R581C probably damaging Het
Tango6 T A 8: 106,742,114 D747E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp945 A G 17: 22,852,365 S187P probably damaging Het
Other mutations in Olfr340
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Olfr340 APN 2 36452644 nonsense probably null
IGL01590:Olfr340 APN 2 36452992 missense probably benign 0.39
IGL01614:Olfr340 APN 2 36452624 missense probably benign 0.32
IGL02470:Olfr340 APN 2 36452597 missense probably benign 0.00
IGL02943:Olfr340 APN 2 36453039 missense probably benign 0.05
R0089:Olfr340 UTSW 2 36453095 missense probably benign 0.00
R0600:Olfr340 UTSW 2 36452648 missense probably benign 0.06
R0881:Olfr340 UTSW 2 36453440 missense probably damaging 1.00
R1945:Olfr340 UTSW 2 36453031 missense probably damaging 1.00
R2184:Olfr340 UTSW 2 36453034 missense probably benign
R2196:Olfr340 UTSW 2 36452588 start codon destroyed probably null 1.00
R2419:Olfr340 UTSW 2 36453326 missense probably damaging 1.00
R2859:Olfr340 UTSW 2 36453130 missense probably benign 0.01
R2964:Olfr340 UTSW 2 36452767 missense probably damaging 1.00
R4677:Olfr340 UTSW 2 36453050 missense probably benign 0.00
R4867:Olfr340 UTSW 2 36453199 missense probably benign
R5468:Olfr340 UTSW 2 36453443 missense probably damaging 0.99
R5582:Olfr340 UTSW 2 36453221 missense probably benign 0.03
R6335:Olfr340 UTSW 2 36452722 missense probably benign 0.22
R6415:Olfr340 UTSW 2 36452605 missense probably damaging 0.99
R6873:Olfr340 UTSW 2 36453496 missense probably benign 0.00
R7097:Olfr340 UTSW 2 36452690 missense probably damaging 1.00
R7122:Olfr340 UTSW 2 36452690 missense probably damaging 1.00
R7199:Olfr340 UTSW 2 36452860 missense probably damaging 1.00
R7275:Olfr340 UTSW 2 36452839 missense probably benign 0.05
R7812:Olfr340 UTSW 2 36453278 missense probably benign 0.00
R8260:Olfr340 UTSW 2 36452885 missense probably damaging 1.00
Z1088:Olfr340 UTSW 2 36452906 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCTGATCTTGAGAGCTTTCTTC -3'
(R):5'- CACATGTGGACAAGGCTTTG -3'

Sequencing Primer
(F):5'- CTGACCTCCATGGCCTATGACAG -3'
(R):5'- GACAAGGCTTTGCAGATTCC -3'
Posted On2018-07-23