Incidental Mutation 'R6664:Gm438'
ID526899
Institutional Source Beutler Lab
Gene Symbol Gm438
Ensembl Gene ENSMUSG00000078504
Gene Namepredicted gene 438
SynonymsLOC329993
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6664 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location144777204-144786583 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 144777399 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 394 (*394W)
Ref Sequence ENSEMBL: ENSMUSP00000101372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105746]
Predicted Effect probably null
Transcript: ENSMUST00000105746
AA Change: *394W
SMART Domains Protein: ENSMUSP00000101372
Gene: ENSMUSG00000078504
AA Change: *394W

DomainStartEndE-ValueType
transmembrane domain 3 25 N/A INTRINSIC
Pfam:Abhydrolase_3 111 270 4.9e-22 PFAM
Pfam:Abhydrolase_3 284 366 1.3e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU040320 A T 4: 126,835,650 Y535F probably damaging Het
Auh G C 13: 52,898,667 S138W probably damaging Het
Bmp2k A T 5: 97,088,130 K1137N probably benign Het
Btn1a1 A G 13: 23,459,320 Y320H probably benign Het
Ccdc18 C T 5: 108,168,100 Q479* probably null Het
Cyp4f18 A T 8: 71,989,915 S399T probably benign Het
Dcaf13 T C 15: 39,118,888 L83P probably damaging Het
Fbxo45 T C 16: 32,238,416 N220S probably damaging Het
Fbxw16 T C 9: 109,438,258 M302V probably benign Het
Fgb A T 3: 83,046,759 S57R probably damaging Het
Fryl A G 5: 73,132,481 V134A probably damaging Het
Gatad2a A G 8: 69,917,489 L189P probably damaging Het
Ifitm7 T C 16: 13,983,749 T49A probably benign Het
Itih1 T C 14: 30,933,436 T601A probably damaging Het
Jmjd4 T C 11: 59,450,419 F59L probably benign Het
Magi2 C T 5: 20,702,397 S1323L probably benign Het
Map3k21 A G 8: 125,941,871 E732G probably benign Het
Nr4a3 G A 4: 48,056,006 R344Q probably damaging Het
Olfr340 A G 2: 36,453,098 N171S probably benign Het
Olfr678 T A 7: 105,070,188 S240R possibly damaging Het
Pik3cb T C 9: 99,094,538 T169A possibly damaging Het
Prl3a1 C A 13: 27,270,211 Y57* probably null Het
Ripor2 A T 13: 24,675,820 I164F probably damaging Het
Sik2 T C 9: 50,935,457 E146G probably damaging Het
Szt2 G A 4: 118,391,745 R581C probably damaging Het
Tango6 T A 8: 106,742,114 D747E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp945 A G 17: 22,852,365 S187P probably damaging Het
Other mutations in Gm438
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Gm438 APN 4 144777689 nonsense probably null
IGL01293:Gm438 APN 4 144777589 missense probably benign 0.00
IGL01678:Gm438 APN 4 144777873 missense probably benign 0.20
IGL02609:Gm438 APN 4 144779737 missense probably damaging 1.00
IGL02684:Gm438 APN 4 144778185 splice site probably benign
IGL02734:Gm438 APN 4 144779779 missense probably damaging 1.00
IGL02869:Gm438 APN 4 144786368 missense probably benign 0.01
IGL02988:Gm438 APN 4 144786530 utr 5 prime probably benign
R0553:Gm438 UTSW 4 144777415 missense possibly damaging 0.57
R1514:Gm438 UTSW 4 144777759 missense probably damaging 1.00
R1856:Gm438 UTSW 4 144777883 missense probably benign
R1957:Gm438 UTSW 4 144777819 missense possibly damaging 0.94
R2014:Gm438 UTSW 4 144779725 missense probably damaging 1.00
R2243:Gm438 UTSW 4 144777421 missense probably benign
R4943:Gm438 UTSW 4 144777720 missense probably benign 0.07
R5439:Gm438 UTSW 4 144778113 missense probably damaging 1.00
R5520:Gm438 UTSW 4 144778024 missense probably benign 0.00
R6414:Gm438 UTSW 4 144777415 missense possibly damaging 0.57
R6869:Gm438 UTSW 4 144780472 critical splice donor site probably null
R7384:Gm438 UTSW 4 144780621 missense possibly damaging 0.89
R7439:Gm438 UTSW 4 144777762 missense probably damaging 1.00
R7484:Gm438 UTSW 4 144777951 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACACTGTATTTGTGGTATAAGAGAG -3'
(R):5'- GACATTCCTGGTGAGCTGTG -3'

Sequencing Primer
(F):5'- GAACACAAATTTGACTTATTGAGCAG -3'
(R):5'- ACATGATGTTCTCCGAGATGATGCC -3'
Posted On2018-07-23