Incidental Mutation 'R6664:Magi2'
ID526900
Institutional Source Beutler Lab
Gene Symbol Magi2
Ensembl Gene ENSMUSG00000040003
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 2
SynonymsMagi-2, S-SCAM, Acvrinp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6664 (G1)
Quality Score130.008
Status Not validated
Chromosome5
Chromosomal Location19227036-20704792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20702397 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1323 (S1323L)
Ref Sequence ENSEMBL: ENSMUSP00000142764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088516] [ENSMUST00000101558] [ENSMUST00000115267] [ENSMUST00000197354] [ENSMUST00000197443]
Predicted Effect probably benign
Transcript: ENSMUST00000088516
SMART Domains Protein: ENSMUSP00000085872
Gene: ENSMUSG00000040003

DomainStartEndE-ValueType
PDZ 26 101 5.26e-9 SMART
GuKc 107 290 2.76e-45 SMART
WW 302 334 7.43e-12 SMART
WW 348 380 2.4e-6 SMART
PDZ 433 509 3.51e-19 SMART
PDZ 612 682 2.3e-14 SMART
PDZ 785 861 4.04e-19 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 5.05e-20 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 3.88e-21 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101556
SMART Domains Protein: ENSMUSP00000099092
Gene: ENSMUSG00000073174

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101558
SMART Domains Protein: ENSMUSP00000099094
Gene: ENSMUSG00000040003

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 608 684 4.04e-19 SMART
low complexity region 716 730 N/A INTRINSIC
PDZ 751 832 5.05e-20 SMART
low complexity region 875 886 N/A INTRINSIC
PDZ 970 1044 3.88e-21 SMART
low complexity region 1080 1093 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115267
SMART Domains Protein: ENSMUSP00000110922
Gene: ENSMUSG00000040003

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 622 698 4.04e-19 SMART
low complexity region 730 744 N/A INTRINSIC
PDZ 765 846 5.05e-20 SMART
low complexity region 889 900 N/A INTRINSIC
PDZ 984 1058 3.88e-21 SMART
low complexity region 1094 1107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197307
Predicted Effect probably benign
Transcript: ENSMUST00000197354
AA Change: S1337L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142576
Gene: ENSMUSG00000040003
AA Change: S1337L

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 785 861 2e-21 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 2.4e-22 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 1.9e-23 SMART
low complexity region 1255 1269 N/A INTRINSIC
low complexity region 1304 1319 N/A INTRINSIC
low complexity region 1344 1363 N/A INTRINSIC
low complexity region 1368 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197443
AA Change: S1323L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142764
Gene: ENSMUSG00000040003
AA Change: S1323L

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 771 847 2e-21 SMART
low complexity region 879 893 N/A INTRINSIC
PDZ 914 995 2.4e-22 SMART
low complexity region 1038 1049 N/A INTRINSIC
PDZ 1133 1207 1.9e-23 SMART
low complexity region 1241 1255 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1354 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199514
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with atrophin-1. Atrophin-1 contains a polyglutamine repeat, expansion of which is responsible for dentatorubral and pallidoluysian atrophy. This encoded protein is characterized by two WW domains, a guanylate kinase-like domain, and multiple PDZ domains. It has structural similarity to the membrane-associated guanylate kinase homologue (MAGUK) family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death and hippocampal neurons with altered dendritic spine morphology. Homozygotes for a different null allele die neonatally due to anuria and podocyte anomalies. Mice lacking all three isoforms develop proteinuria, podocytopathy and die of renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU040320 A T 4: 126,835,650 Y535F probably damaging Het
Auh G C 13: 52,898,667 S138W probably damaging Het
Bmp2k A T 5: 97,088,130 K1137N probably benign Het
Btn1a1 A G 13: 23,459,320 Y320H probably benign Het
Ccdc18 C T 5: 108,168,100 Q479* probably null Het
Cyp4f18 A T 8: 71,989,915 S399T probably benign Het
Dcaf13 T C 15: 39,118,888 L83P probably damaging Het
Fbxo45 T C 16: 32,238,416 N220S probably damaging Het
Fbxw16 T C 9: 109,438,258 M302V probably benign Het
Fgb A T 3: 83,046,759 S57R probably damaging Het
Fryl A G 5: 73,132,481 V134A probably damaging Het
Gatad2a A G 8: 69,917,489 L189P probably damaging Het
Gm438 T C 4: 144,777,399 *394W probably null Het
Ifitm7 T C 16: 13,983,749 T49A probably benign Het
Itih1 T C 14: 30,933,436 T601A probably damaging Het
Jmjd4 T C 11: 59,450,419 F59L probably benign Het
Map3k21 A G 8: 125,941,871 E732G probably benign Het
Nr4a3 G A 4: 48,056,006 R344Q probably damaging Het
Olfr340 A G 2: 36,453,098 N171S probably benign Het
Olfr678 T A 7: 105,070,188 S240R possibly damaging Het
Pik3cb T C 9: 99,094,538 T169A possibly damaging Het
Prl3a1 C A 13: 27,270,211 Y57* probably null Het
Ripor2 A T 13: 24,675,820 I164F probably damaging Het
Sik2 T C 9: 50,935,457 E146G probably damaging Het
Szt2 G A 4: 118,391,745 R581C probably damaging Het
Tango6 T A 8: 106,742,114 D747E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp945 A G 17: 22,852,365 S187P probably damaging Het
Other mutations in Magi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Magi2 APN 5 20391301 missense probably benign 0.05
IGL02120:Magi2 APN 5 20228453 critical splice donor site probably null
IGL02341:Magi2 APN 5 20466203 missense probably damaging 1.00
IGL02411:Magi2 APN 5 19678709 missense probably damaging 1.00
IGL02657:Magi2 APN 5 19227583 missense probably damaging 0.99
IGL02976:Magi2 APN 5 20534475 missense probably damaging 1.00
IGL03105:Magi2 APN 5 20543618 missense probably damaging 0.97
IGL03246:Magi2 APN 5 20358950 missense probably damaging 1.00
IGL03329:Magi2 APN 5 20466128 missense possibly damaging 0.95
LCD18:Magi2 UTSW 5 19954511 intron probably benign
PIT4519001:Magi2 UTSW 5 20661346 missense probably damaging 1.00
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0352:Magi2 UTSW 5 20065666 missense probably damaging 1.00
R0362:Magi2 UTSW 5 19227575 missense probably damaging 1.00
R0496:Magi2 UTSW 5 20661359 splice site probably benign
R1103:Magi2 UTSW 5 20611103 missense probably damaging 1.00
R1435:Magi2 UTSW 5 20358945 missense probably damaging 1.00
R1583:Magi2 UTSW 5 19227332 missense probably benign 0.30
R1616:Magi2 UTSW 5 20609326 missense probably damaging 1.00
R1643:Magi2 UTSW 5 20705506 unclassified probably benign
R1707:Magi2 UTSW 5 20215493 missense probably damaging 1.00
R1833:Magi2 UTSW 5 19227457 missense probably damaging 1.00
R1837:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1838:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1839:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1847:Magi2 UTSW 5 20602460 missense probably damaging 0.99
R2223:Magi2 UTSW 5 20465672 missense probably damaging 1.00
R2496:Magi2 UTSW 5 19678752 missense probably benign 0.42
R2504:Magi2 UTSW 5 20358936 missense probably damaging 1.00
R2848:Magi2 UTSW 5 20602461 frame shift probably null
R2879:Magi2 UTSW 5 20602461 frame shift probably null
R2935:Magi2 UTSW 5 20602461 frame shift probably null
R2936:Magi2 UTSW 5 20602461 frame shift probably null
R3694:Magi2 UTSW 5 20602461 frame shift probably null
R3783:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3786:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3787:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3837:Magi2 UTSW 5 20215468 missense probably benign 0.28
R4151:Magi2 UTSW 5 19227292 missense probably damaging 0.97
R4721:Magi2 UTSW 5 20534469 missense probably damaging 1.00
R5005:Magi2 UTSW 5 20534446 missense probably damaging 0.98
R5012:Magi2 UTSW 5 20465620 missense probably damaging 0.99
R5193:Magi2 UTSW 5 20358972 critical splice donor site probably null
R5298:Magi2 UTSW 5 20569162 missense probably damaging 1.00
R5372:Magi2 UTSW 5 20702110 missense possibly damaging 0.82
R5580:Magi2 UTSW 5 20215424 missense probably benign 0.03
R5806:Magi2 UTSW 5 20651204 missense probably benign 0.01
R5924:Magi2 UTSW 5 20611069 missense probably benign 0.00
R5992:Magi2 UTSW 5 19227291 start codon destroyed probably null 0.42
R6014:Magi2 UTSW 5 20611093 missense probably damaging 1.00
R6073:Magi2 UTSW 5 20569288 missense probably damaging 1.00
R6500:Magi2 UTSW 5 20602347 missense possibly damaging 0.94
R7229:Magi2 UTSW 5 20465588 missense probably damaging 1.00
R7344:Magi2 UTSW 5 20550240 missense probably benign 0.19
R7448:Magi2 UTSW 5 20358956 missense probably damaging 1.00
R7605:Magi2 UTSW 5 20228385 missense probably damaging 1.00
R7712:Magi2 UTSW 5 20550282 missense possibly damaging 0.78
R7808:Magi2 UTSW 5 20465840 missense probably benign 0.03
X0065:Magi2 UTSW 5 20569178 missense possibly damaging 0.94
Z1176:Magi2 UTSW 5 20702109 missense probably benign 0.32
Z1177:Magi2 UTSW 5 20702412 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGGCCCAGACCCAACTTG -3'
(R):5'- AATTAAAACGCCGTGAGACG -3'

Sequencing Primer
(F):5'- CACGACGTTAGGAAACCA -3'
(R):5'- GAACCCAGGAAGATCGGCC -3'
Posted On2018-07-23