Incidental Mutation 'R6664:Bmp2k'
ID526902
Institutional Source Beutler Lab
Gene Symbol Bmp2k
Ensembl Gene ENSMUSG00000034663
Gene NameBMP2 inducible kinase
Synonyms4933417M22Rik, BIKE
MMRRC Submission
Accession Numbers

Genbank: NM_080708; MGI: 2155456

Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R6664 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location96997689-97091867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97088130 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1137 (K1137N)
Ref Sequence ENSEMBL: ENSMUSP00000037970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035635] [ENSMUST00000069453] [ENSMUST00000112969]
Predicted Effect probably benign
Transcript: ENSMUST00000035635
AA Change: K1137N

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000037970
Gene: ENSMUSG00000034663
AA Change: K1137N

DomainStartEndE-ValueType
low complexity region 12 37 N/A INTRINSIC
Pfam:Pkinase_Tyr 48 309 8.9e-27 PFAM
Pfam:Pkinase 48 311 1.6e-43 PFAM
coiled coil region 455 490 N/A INTRINSIC
low complexity region 511 538 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 838 852 N/A INTRINSIC
Pfam:BMP2K_C 873 1138 7.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069453
SMART Domains Protein: ENSMUSP00000069324
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 3.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112969
SMART Domains Protein: ENSMUSP00000108593
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 1.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human homolog of mouse BMP-2-inducible kinase. Bone morphogenic proteins (BMPs) play a key role in skeletal development and patterning. Expression of the mouse gene is increased during BMP-2 induced differentiation and the gene product is a putative serine/threonine protein kinase containing a nuclear localization signal. Therefore, the protein encoded by this human homolog is thought to be a protein kinase with a putative regulatory role in attenuating the program of osteoblast differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU040320 A T 4: 126,835,650 Y535F probably damaging Het
Auh G C 13: 52,898,667 S138W probably damaging Het
Btn1a1 A G 13: 23,459,320 Y320H probably benign Het
Ccdc18 C T 5: 108,168,100 Q479* probably null Het
Cyp4f18 A T 8: 71,989,915 S399T probably benign Het
Dcaf13 T C 15: 39,118,888 L83P probably damaging Het
Fbxo45 T C 16: 32,238,416 N220S probably damaging Het
Fbxw16 T C 9: 109,438,258 M302V probably benign Het
Fgb A T 3: 83,046,759 S57R probably damaging Het
Fryl A G 5: 73,132,481 V134A probably damaging Het
Gatad2a A G 8: 69,917,489 L189P probably damaging Het
Gm438 T C 4: 144,777,399 *394W probably null Het
Ifitm7 T C 16: 13,983,749 T49A probably benign Het
Itih1 T C 14: 30,933,436 T601A probably damaging Het
Jmjd4 T C 11: 59,450,419 F59L probably benign Het
Magi2 C T 5: 20,702,397 S1323L probably benign Het
Map3k21 A G 8: 125,941,871 E732G probably benign Het
Nr4a3 G A 4: 48,056,006 R344Q probably damaging Het
Olfr340 A G 2: 36,453,098 N171S probably benign Het
Olfr678 T A 7: 105,070,188 S240R possibly damaging Het
Pik3cb T C 9: 99,094,538 T169A possibly damaging Het
Prl3a1 C A 13: 27,270,211 Y57* probably null Het
Ripor2 A T 13: 24,675,820 I164F probably damaging Het
Sik2 T C 9: 50,935,457 E146G probably damaging Het
Szt2 G A 4: 118,391,745 R581C probably damaging Het
Tango6 T A 8: 106,742,114 D747E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp945 A G 17: 22,852,365 S187P probably damaging Het
Other mutations in Bmp2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Bmp2k APN 5 97063548 splice site probably null
IGL01408:Bmp2k APN 5 97086964 nonsense probably null
IGL02146:Bmp2k APN 5 97064830 missense unknown
IGL02232:Bmp2k APN 5 97031250 splice site probably benign
3-1:Bmp2k UTSW 5 97053120 missense possibly damaging 0.68
R0277:Bmp2k UTSW 5 97087823 utr 3 prime probably benign
R0284:Bmp2k UTSW 5 97068455 missense unknown
R0323:Bmp2k UTSW 5 97087823 utr 3 prime probably benign
R0384:Bmp2k UTSW 5 97031125 splice site probably benign
R0726:Bmp2k UTSW 5 97087494 utr 3 prime probably benign
R1479:Bmp2k UTSW 5 97053200 missense probably benign 0.16
R1686:Bmp2k UTSW 5 97063533 missense unknown
R1826:Bmp2k UTSW 5 97061402 splice site probably benign
R3842:Bmp2k UTSW 5 97087151 utr 3 prime probably benign
R3919:Bmp2k UTSW 5 97074740 missense unknown
R4649:Bmp2k UTSW 5 97053111 missense possibly damaging 0.95
R4954:Bmp2k UTSW 5 97086764 unclassified probably benign
R4975:Bmp2k UTSW 5 97087085 utr 3 prime probably benign
R5001:Bmp2k UTSW 5 97053142 missense probably damaging 1.00
R5122:Bmp2k UTSW 5 97087015 utr 3 prime probably benign
R5260:Bmp2k UTSW 5 97087351 utr 3 prime probably benign
R5516:Bmp2k UTSW 5 97087453 utr 3 prime probably benign
R5762:Bmp2k UTSW 5 97087191 frame shift probably null
R5807:Bmp2k UTSW 5 97063494 missense unknown
R5835:Bmp2k UTSW 5 97056982 missense possibly damaging 0.95
R5928:Bmp2k UTSW 5 97087736 utr 3 prime probably benign
R6012:Bmp2k UTSW 5 97063608 intron probably null
R6546:Bmp2k UTSW 5 97088078 missense probably benign 0.32
R6962:Bmp2k UTSW 5 97031238 nonsense probably null
R7081:Bmp2k UTSW 5 97064961 missense unknown
R7267:Bmp2k UTSW 5 97068434 missense unknown
R7473:Bmp2k UTSW 5 97057012 missense probably benign 0.40
R7498:Bmp2k UTSW 5 97088119 missense probably benign 0.03
R7659:Bmp2k UTSW 5 97074719 missense unknown
X0026:Bmp2k UTSW 5 97038533 missense probably damaging 1.00
Z1177:Bmp2k UTSW 5 97053156 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCTGCGTTGATCACACCACC -3'
(R):5'- TCCTGCTTGAAGAAGGCATC -3'

Sequencing Primer
(F):5'- ACCACCATTTTGCCTGGGAG -3'
(R):5'- TGCTTGAAGAAGGCATCCACTTAC -3'
Posted On2018-07-23