Incidental Mutation 'R6664:Map3k21'
ID526908
Institutional Source Beutler Lab
Gene Symbol Map3k21
Ensembl Gene ENSMUSG00000031853
Gene Namemitogen-activated protein kinase kinase kinase 21
SynonymsBC021891
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R6664 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125910450-125947440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125941871 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 732 (E732G)
Ref Sequence ENSEMBL: ENSMUSP00000034316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034316]
Predicted Effect probably benign
Transcript: ENSMUST00000034316
AA Change: E732G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034316
Gene: ENSMUSG00000031853
AA Change: E732G

DomainStartEndE-ValueType
SH3 27 87 1.1e-18 SMART
TyrKc 110 382 6.04e-82 SMART
coiled coil region 402 474 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
low complexity region 661 677 N/A INTRINSIC
low complexity region 740 758 N/A INTRINSIC
low complexity region 766 788 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU040320 A T 4: 126,835,650 Y535F probably damaging Het
Auh G C 13: 52,898,667 S138W probably damaging Het
Bmp2k A T 5: 97,088,130 K1137N probably benign Het
Btn1a1 A G 13: 23,459,320 Y320H probably benign Het
Ccdc18 C T 5: 108,168,100 Q479* probably null Het
Cyp4f18 A T 8: 71,989,915 S399T probably benign Het
Dcaf13 T C 15: 39,118,888 L83P probably damaging Het
Fbxo45 T C 16: 32,238,416 N220S probably damaging Het
Fbxw16 T C 9: 109,438,258 M302V probably benign Het
Fgb A T 3: 83,046,759 S57R probably damaging Het
Fryl A G 5: 73,132,481 V134A probably damaging Het
Gatad2a A G 8: 69,917,489 L189P probably damaging Het
Gm438 T C 4: 144,777,399 *394W probably null Het
Ifitm7 T C 16: 13,983,749 T49A probably benign Het
Itih1 T C 14: 30,933,436 T601A probably damaging Het
Jmjd4 T C 11: 59,450,419 F59L probably benign Het
Magi2 C T 5: 20,702,397 S1323L probably benign Het
Nr4a3 G A 4: 48,056,006 R344Q probably damaging Het
Olfr340 A G 2: 36,453,098 N171S probably benign Het
Olfr678 T A 7: 105,070,188 S240R possibly damaging Het
Pik3cb T C 9: 99,094,538 T169A possibly damaging Het
Prl3a1 C A 13: 27,270,211 Y57* probably null Het
Ripor2 A T 13: 24,675,820 I164F probably damaging Het
Sik2 T C 9: 50,935,457 E146G probably damaging Het
Szt2 G A 4: 118,391,745 R581C probably damaging Het
Tango6 T A 8: 106,742,114 D747E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp945 A G 17: 22,852,365 S187P probably damaging Het
Other mutations in Map3k21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Map3k21 APN 8 125944673 missense possibly damaging 0.52
IGL01919:Map3k21 APN 8 125942132 missense probably damaging 0.97
IGL02065:Map3k21 APN 8 125941658 missense probably benign 0.01
IGL02123:Map3k21 APN 8 125926110 missense probably damaging 1.00
IGL02127:Map3k21 APN 8 125942147 missense probably benign
IGL02863:Map3k21 APN 8 125927541 missense probably benign 0.02
IGL03194:Map3k21 APN 8 125924062 missense possibly damaging 0.90
PIT4142001:Map3k21 UTSW 8 125937308 missense probably damaging 0.98
R0238:Map3k21 UTSW 8 125944970 missense possibly damaging 0.67
R0238:Map3k21 UTSW 8 125944970 missense possibly damaging 0.67
R0454:Map3k21 UTSW 8 125942119 missense probably benign
R0654:Map3k21 UTSW 8 125942020 missense probably benign 0.07
R1141:Map3k21 UTSW 8 125941732 missense probably benign 0.32
R1177:Map3k21 UTSW 8 125944838 missense probably benign 0.31
R1463:Map3k21 UTSW 8 125942137 missense probably benign 0.00
R1472:Map3k21 UTSW 8 125941678 missense probably benign
R1759:Map3k21 UTSW 8 125944780 missense probably benign
R1988:Map3k21 UTSW 8 125927555 missense probably benign 0.07
R2058:Map3k21 UTSW 8 125938722 missense probably benign 0.01
R2117:Map3k21 UTSW 8 125924042 missense probably benign 0.19
R2157:Map3k21 UTSW 8 125937266 missense probably benign
R2436:Map3k21 UTSW 8 125941615 nonsense probably null
R2507:Map3k21 UTSW 8 125939938 missense possibly damaging 0.73
R3125:Map3k21 UTSW 8 125941854 missense probably benign 0.26
R3746:Map3k21 UTSW 8 125935100 missense probably damaging 1.00
R4016:Map3k21 UTSW 8 125911185 missense probably damaging 1.00
R4647:Map3k21 UTSW 8 125942111 missense probably benign
R4648:Map3k21 UTSW 8 125942111 missense probably benign
R4864:Map3k21 UTSW 8 125927555 missense probably benign 0.04
R5642:Map3k21 UTSW 8 125938824 missense probably benign 0.17
R5694:Map3k21 UTSW 8 125944768 missense probably benign 0.04
R5950:Map3k21 UTSW 8 125941760 missense possibly damaging 0.93
R5982:Map3k21 UTSW 8 125911430 missense probably damaging 1.00
R6440:Map3k21 UTSW 8 125911137 missense probably damaging 1.00
R6550:Map3k21 UTSW 8 125937292 missense probably damaging 1.00
R6668:Map3k21 UTSW 8 125926113 missense possibly damaging 0.60
R6788:Map3k21 UTSW 8 125939866 missense probably benign 0.28
R7369:Map3k21 UTSW 8 125911116 missense possibly damaging 0.86
R7371:Map3k21 UTSW 8 125935065 missense probably damaging 0.99
R7381:Map3k21 UTSW 8 125944978 missense possibly damaging 0.83
R7388:Map3k21 UTSW 8 125927597 missense probably damaging 1.00
R7397:Map3k21 UTSW 8 125935116 missense probably damaging 1.00
R7497:Map3k21 UTSW 8 125927601 missense probably damaging 0.99
R7562:Map3k21 UTSW 8 125938800 missense probably damaging 1.00
R7564:Map3k21 UTSW 8 125927708 critical splice donor site probably null
R7824:Map3k21 UTSW 8 125910963 missense probably benign 0.01
R8351:Map3k21 UTSW 8 125944733 missense probably benign 0.00
R8451:Map3k21 UTSW 8 125944733 missense probably benign 0.00
R8461:Map3k21 UTSW 8 125944622 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTACCTCTTTGCAAAGACAGCC -3'
(R):5'- GCAGCAAACACTTCATGGAG -3'

Sequencing Primer
(F):5'- CTCATCAGAGGCTGAGAGTCG -3'
(R):5'- CACTTCATGGAGAGAGAAGACTTTG -3'
Posted On2018-07-23