Incidental Mutation 'R6664:Prl3a1'
ID526915
Institutional Source Beutler Lab
Gene Symbol Prl3a1
Ensembl Gene ENSMUSG00000038883
Gene Nameprolactin family 3, subfamily a, member 1
SynonymsPLP-I, 1600016E11Rik, Prlpi, Plpi, PLP-H
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6664 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location27259436-27276667 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 27270211 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 57 (Y57*)
Ref Sequence ENSEMBL: ENSMUSP00000046522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049463]
Predicted Effect probably null
Transcript: ENSMUST00000049463
AA Change: Y57*
SMART Domains Protein: ENSMUSP00000046522
Gene: ENSMUSG00000038883
AA Change: Y57*

DomainStartEndE-ValueType
Pfam:Hormone_1 16 227 2.3e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223739
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU040320 A T 4: 126,835,650 Y535F probably damaging Het
Auh G C 13: 52,898,667 S138W probably damaging Het
Bmp2k A T 5: 97,088,130 K1137N probably benign Het
Btn1a1 A G 13: 23,459,320 Y320H probably benign Het
Ccdc18 C T 5: 108,168,100 Q479* probably null Het
Cyp4f18 A T 8: 71,989,915 S399T probably benign Het
Dcaf13 T C 15: 39,118,888 L83P probably damaging Het
Fbxo45 T C 16: 32,238,416 N220S probably damaging Het
Fbxw16 T C 9: 109,438,258 M302V probably benign Het
Fgb A T 3: 83,046,759 S57R probably damaging Het
Fryl A G 5: 73,132,481 V134A probably damaging Het
Gatad2a A G 8: 69,917,489 L189P probably damaging Het
Gm438 T C 4: 144,777,399 *394W probably null Het
Ifitm7 T C 16: 13,983,749 T49A probably benign Het
Itih1 T C 14: 30,933,436 T601A probably damaging Het
Jmjd4 T C 11: 59,450,419 F59L probably benign Het
Magi2 C T 5: 20,702,397 S1323L probably benign Het
Map3k21 A G 8: 125,941,871 E732G probably benign Het
Nr4a3 G A 4: 48,056,006 R344Q probably damaging Het
Olfr340 A G 2: 36,453,098 N171S probably benign Het
Olfr678 T A 7: 105,070,188 S240R possibly damaging Het
Pik3cb T C 9: 99,094,538 T169A possibly damaging Het
Ripor2 A T 13: 24,675,820 I164F probably damaging Het
Sik2 T C 9: 50,935,457 E146G probably damaging Het
Szt2 G A 4: 118,391,745 R581C probably damaging Het
Tango6 T A 8: 106,742,114 D747E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp945 A G 17: 22,852,365 S187P probably damaging Het
Other mutations in Prl3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Prl3a1 APN 13 27270144 missense probably benign 0.13
IGL02648:Prl3a1 APN 13 27270235 missense probably benign 0.00
R1405:Prl3a1 UTSW 13 27275068 intron probably null
R1405:Prl3a1 UTSW 13 27275068 intron probably null
R1596:Prl3a1 UTSW 13 27259617 start gained probably benign
R1823:Prl3a1 UTSW 13 27270194 missense probably damaging 0.99
R1952:Prl3a1 UTSW 13 27270153 missense possibly damaging 0.91
R2059:Prl3a1 UTSW 13 27270144 missense probably benign 0.13
R5843:Prl3a1 UTSW 13 27270110 missense probably damaging 1.00
R6222:Prl3a1 UTSW 13 27276114 missense probably benign 0.05
R7077:Prl3a1 UTSW 13 27276103 missense probably benign 0.35
R7846:Prl3a1 UTSW 13 27272459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGTTAACGCTTGCAAC -3'
(R):5'- GAGATTTTATGGAATTCCCCATCCTC -3'

Sequencing Primer
(F):5'- ACGCTTGCAACTTTGTTTGAATG -3'
(R):5'- ATGGAATTCCCCATCCTCTCTATAC -3'
Posted On2018-07-23