Incidental Mutation 'R6665:Ccdc146'
ID526928
Institutional Source Beutler Lab
Gene Symbol Ccdc146
Ensembl Gene ENSMUSG00000064280
Gene Namecoiled-coil domain containing 146
Synonyms4930528G09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6665 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location21292961-21424677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21303094 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 652 (Y652C)
Ref Sequence ENSEMBL: ENSMUSP00000110900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115245] [ENSMUST00000198930]
Predicted Effect probably damaging
Transcript: ENSMUST00000115245
AA Change: Y652C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280
AA Change: Y652C

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
coiled coil region 438 477 N/A INTRINSIC
coiled coil region 549 595 N/A INTRINSIC
coiled coil region 617 663 N/A INTRINSIC
coiled coil region 690 720 N/A INTRINSIC
coiled coil region 770 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199553
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (34/34)
MGI Phenotype Homozygous null mice for one allele have unaltered type 1 immunity responses. Homozygous null mice for another allele show partial embryonic lethality, hemorrhage at implantation sites, decreased susceptibility to hepatitis virus infection and prolonged survival of heart grafts.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,904,479 probably null Het
Adamts16 T G 13: 70,779,570 K517Q probably damaging Het
Atp9b A C 18: 80,917,735 V87G probably benign Het
Avil A G 10: 127,020,525 K808E probably damaging Het
Bin2 T C 15: 100,656,795 E49G probably damaging Het
Cd6 T C 19: 10,791,003 N541D probably benign Het
Col28a1 A G 6: 8,062,277 V671A probably benign Het
Dock6 C T 9: 21,839,912 C355Y probably damaging Het
Dsc2 A G 18: 20,050,148 F71S probably damaging Het
Dusp8 G A 7: 142,090,105 P24S probably damaging Het
Dysf A G 6: 84,130,116 Y1151C probably benign Het
Fam160b2 A T 14: 70,585,638 L659Q probably damaging Het
Frem2 T C 3: 53,654,656 Y810C probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hexb T C 13: 97,179,385 N380D probably benign Het
Ice1 T C 13: 70,603,473 E1498G possibly damaging Het
Lrif1 T A 3: 106,735,343 probably null Het
Myo9a G T 9: 59,871,872 G1637V probably benign Het
Myod1 A T 7: 46,376,857 H62L probably damaging Het
Myoz3 A C 18: 60,576,423 L222R probably damaging Het
Naca T A 10: 128,048,358 N2180K probably damaging Het
Olfr809 T C 10: 129,776,247 F111S probably damaging Het
Pik3cb A G 9: 99,073,649 V405A probably benign Het
Prkdc T C 16: 15,786,050 probably null Het
Rab32 T C 10: 10,558,102 probably benign Het
Serpinb10 A C 1: 107,546,867 N253T possibly damaging Het
Slc13a5 C T 11: 72,260,360 V131I probably damaging Het
Slc25a40 A G 5: 8,452,788 N290S probably benign Het
Slc6a6 T C 6: 91,726,039 V131A probably benign Het
Spef2 A T 15: 9,600,518 probably null Het
Stxbp2 A G 8: 3,641,998 M547V probably benign Het
Tmem247 A T 17: 86,918,570 Q146L probably benign Het
Vmn2r67 T C 7: 85,136,692 I702V probably benign Het
Zmynd15 T C 11: 70,464,810 S436P probably benign Het
Other mutations in Ccdc146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc146 APN 5 21301422 missense possibly damaging 0.93
IGL01066:Ccdc146 APN 5 21319542 missense probably benign 0.03
IGL01399:Ccdc146 APN 5 21294613 missense possibly damaging 0.75
IGL01866:Ccdc146 APN 5 21333054 missense probably damaging 0.99
IGL01868:Ccdc146 APN 5 21333054 missense probably damaging 0.99
IGL01869:Ccdc146 APN 5 21316839 missense probably benign 0.25
IGL02213:Ccdc146 APN 5 21316904 missense probably benign 0.10
IGL02338:Ccdc146 APN 5 21319606 unclassified probably benign
IGL02553:Ccdc146 APN 5 21297633 missense probably benign 0.00
IGL02838:Ccdc146 APN 5 21297569 missense probably benign 0.01
Starcraft UTSW 5 21399614 splice site probably null
R0051:Ccdc146 UTSW 5 21316904 missense possibly damaging 0.58
R0051:Ccdc146 UTSW 5 21316904 missense possibly damaging 0.58
R0055:Ccdc146 UTSW 5 21297006 synonymous probably null
R0115:Ccdc146 UTSW 5 21322756 missense possibly damaging 0.87
R0373:Ccdc146 UTSW 5 21319545 missense probably benign 0.00
R1251:Ccdc146 UTSW 5 21293372 missense probably benign 0.00
R1355:Ccdc146 UTSW 5 21321242 missense probably damaging 1.00
R1405:Ccdc146 UTSW 5 21399732 missense probably benign 0.00
R1405:Ccdc146 UTSW 5 21399732 missense probably benign 0.00
R1470:Ccdc146 UTSW 5 21319566 missense probably damaging 1.00
R1470:Ccdc146 UTSW 5 21319566 missense probably damaging 1.00
R1556:Ccdc146 UTSW 5 21330553 missense probably damaging 1.00
R1613:Ccdc146 UTSW 5 21294524 missense probably damaging 0.99
R1872:Ccdc146 UTSW 5 21301290 missense probably benign 0.01
R2271:Ccdc146 UTSW 5 21399721 missense probably benign 0.15
R2329:Ccdc146 UTSW 5 21308612 critical splice donor site probably null
R2518:Ccdc146 UTSW 5 21305528 missense probably benign
R2680:Ccdc146 UTSW 5 21305269 missense possibly damaging 0.58
R3116:Ccdc146 UTSW 5 21316955 missense probably benign 0.02
R3121:Ccdc146 UTSW 5 21294593 missense possibly damaging 0.56
R3122:Ccdc146 UTSW 5 21294593 missense possibly damaging 0.56
R3159:Ccdc146 UTSW 5 21399792 missense unknown
R3436:Ccdc146 UTSW 5 21297005 missense possibly damaging 0.92
R4043:Ccdc146 UTSW 5 21316943 missense probably benign 0.14
R4226:Ccdc146 UTSW 5 21322758 missense probably benign 0.09
R4493:Ccdc146 UTSW 5 21303193 missense possibly damaging 0.92
R5013:Ccdc146 UTSW 5 21333038 missense probably damaging 1.00
R5024:Ccdc146 UTSW 5 21399614 splice site probably null
R5051:Ccdc146 UTSW 5 21303083 missense possibly damaging 0.77
R5384:Ccdc146 UTSW 5 21308713 missense probably benign 0.37
R5532:Ccdc146 UTSW 5 21305331 missense probably benign 0.02
R5906:Ccdc146 UTSW 5 21301352 missense possibly damaging 0.88
R5927:Ccdc146 UTSW 5 21308621 nonsense probably null
R5951:Ccdc146 UTSW 5 21319579 missense possibly damaging 0.84
R5978:Ccdc146 UTSW 5 21316968 missense probably benign 0.02
R5990:Ccdc146 UTSW 5 21318182 missense probably benign 0.41
R6123:Ccdc146 UTSW 5 21305597 missense possibly damaging 0.93
R6217:Ccdc146 UTSW 5 21317902 intron probably null
R6276:Ccdc146 UTSW 5 21301340 missense probably damaging 0.98
R7077:Ccdc146 UTSW 5 21305274 missense possibly damaging 0.94
R7204:Ccdc146 UTSW 5 21308626 missense probably benign 0.22
R7336:Ccdc146 UTSW 5 21303112 missense probably benign 0.41
R7608:Ccdc146 UTSW 5 21301452 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGATGACTTTGTTCTTCAACTGCC -3'
(R):5'- AATGATCTTCCCCACTGTGC -3'

Sequencing Primer
(F):5'- GACTTTGTTCTTCAACTGCCCCAAC -3'
(R):5'- CCCCACTGTGCCATTATTTTAAAAG -3'
Posted On2018-07-23