Incidental Mutation 'R6665:Col28a1'
ID526929
Institutional Source Beutler Lab
Gene Symbol Col28a1
Ensembl Gene ENSMUSG00000068794
Gene Namecollagen, type XXVIII, alpha 1
SynonymsCol28; Gm466
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6665 (G1)
Quality Score173.009
Status Validated
Chromosome6
Chromosomal Location7997808-8192617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8062277 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 671 (V671A)
Ref Sequence ENSEMBL: ENSMUSP00000111199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115537]
Predicted Effect probably benign
Transcript: ENSMUST00000115537
AA Change: V671A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111199
Gene: ENSMUSG00000068794
AA Change: V671A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 46 225 8.08e-18 SMART
low complexity region 245 260 N/A INTRINSIC
internal_repeat_1 261 304 1.56e-15 PROSPERO
low complexity region 306 363 N/A INTRINSIC
low complexity region 375 422 N/A INTRINSIC
low complexity region 438 479 N/A INTRINSIC
internal_repeat_4 481 531 4.11e-8 PROSPERO
Pfam:Collagen 534 591 1.5e-8 PFAM
low complexity region 640 661 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
internal_repeat_4 690 739 4.11e-8 PROSPERO
internal_repeat_1 711 763 1.56e-15 PROSPERO
internal_repeat_5 713 769 4.35e-6 PROSPERO
low complexity region 771 789 N/A INTRINSIC
VWA 796 973 1.57e-38 SMART
KU 1086 1139 8.16e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL28A1 belongs to a class of collagens containing von Willebrand factor (VWF; MIM 613160) type A (VWFA) domains (Veit et al., 2006 [PubMed 16330543]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,904,479 probably null Het
Adamts16 T G 13: 70,779,570 K517Q probably damaging Het
Atp9b A C 18: 80,917,735 V87G probably benign Het
Avil A G 10: 127,020,525 K808E probably damaging Het
Bin2 T C 15: 100,656,795 E49G probably damaging Het
Ccdc146 T C 5: 21,303,094 Y652C probably damaging Het
Cd6 T C 19: 10,791,003 N541D probably benign Het
Dock6 C T 9: 21,839,912 C355Y probably damaging Het
Dsc2 A G 18: 20,050,148 F71S probably damaging Het
Dusp8 G A 7: 142,090,105 P24S probably damaging Het
Dysf A G 6: 84,130,116 Y1151C probably benign Het
Fam160b2 A T 14: 70,585,638 L659Q probably damaging Het
Frem2 T C 3: 53,654,656 Y810C probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hexb T C 13: 97,179,385 N380D probably benign Het
Ice1 T C 13: 70,603,473 E1498G possibly damaging Het
Lrif1 T A 3: 106,735,343 probably null Het
Myo9a G T 9: 59,871,872 G1637V probably benign Het
Myod1 A T 7: 46,376,857 H62L probably damaging Het
Myoz3 A C 18: 60,576,423 L222R probably damaging Het
Naca T A 10: 128,048,358 N2180K probably damaging Het
Olfr809 T C 10: 129,776,247 F111S probably damaging Het
Pik3cb A G 9: 99,073,649 V405A probably benign Het
Prkdc T C 16: 15,786,050 probably null Het
Rab32 T C 10: 10,558,102 probably benign Het
Serpinb10 A C 1: 107,546,867 N253T possibly damaging Het
Slc13a5 C T 11: 72,260,360 V131I probably damaging Het
Slc25a40 A G 5: 8,452,788 N290S probably benign Het
Slc6a6 T C 6: 91,726,039 V131A probably benign Het
Spef2 A T 15: 9,600,518 probably null Het
Stxbp2 A G 8: 3,641,998 M547V probably benign Het
Tmem247 A T 17: 86,918,570 Q146L probably benign Het
Vmn2r67 T C 7: 85,136,692 I702V probably benign Het
Zmynd15 T C 11: 70,464,810 S436P probably benign Het
Other mutations in Col28a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Col28a1 APN 6 8014795 missense probably damaging 1.00
IGL00329:Col28a1 APN 6 8175425 missense probably damaging 1.00
IGL00466:Col28a1 APN 6 8022081 splice site probably benign
IGL00544:Col28a1 APN 6 8162228 critical splice acceptor site probably null
IGL00979:Col28a1 APN 6 8014810 missense probably damaging 1.00
IGL01475:Col28a1 APN 6 8103521 missense probably damaging 0.98
IGL01570:Col28a1 APN 6 8014540 missense probably damaging 0.99
IGL01688:Col28a1 APN 6 7998517 missense probably damaging 1.00
IGL01734:Col28a1 APN 6 8158134 missense probably damaging 0.99
IGL01911:Col28a1 APN 6 8014963 missense probably damaging 1.00
IGL01922:Col28a1 APN 6 8158133 missense probably damaging 0.96
IGL02567:Col28a1 APN 6 8014819 missense possibly damaging 0.91
IGL02641:Col28a1 APN 6 8014794 nonsense probably null
IGL02893:Col28a1 APN 6 8103534 missense probably damaging 1.00
IGL03062:Col28a1 APN 6 8017029 splice site probably benign
IGL03273:Col28a1 APN 6 8103484 splice site probably benign
P0043:Col28a1 UTSW 6 8168152 unclassified probably benign
R0034:Col28a1 UTSW 6 8175708 missense probably benign 0.32
R0543:Col28a1 UTSW 6 8075326 splice site probably benign
R0646:Col28a1 UTSW 6 8175291 missense possibly damaging 0.88
R0726:Col28a1 UTSW 6 8014495 critical splice donor site probably null
R1013:Col28a1 UTSW 6 7999452 splice site probably benign
R1054:Col28a1 UTSW 6 8175534 missense probably damaging 0.96
R1671:Col28a1 UTSW 6 8083773 missense possibly damaging 0.84
R1804:Col28a1 UTSW 6 8164612 critical splice donor site probably null
R1853:Col28a1 UTSW 6 8014574 missense probably benign 0.03
R1906:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R1914:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1915:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1954:Col28a1 UTSW 6 7998516 missense probably damaging 1.00
R1997:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R2011:Col28a1 UTSW 6 8059360 missense probably benign 0.05
R2023:Col28a1 UTSW 6 8083783 missense possibly damaging 0.66
R2149:Col28a1 UTSW 6 8155383 missense possibly damaging 0.83
R2285:Col28a1 UTSW 6 8097078 missense probably damaging 0.98
R2403:Col28a1 UTSW 6 8175641 missense possibly damaging 0.79
R3615:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3616:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3837:Col28a1 UTSW 6 8014601 missense possibly damaging 0.81
R4042:Col28a1 UTSW 6 8014678 missense probably damaging 0.98
R4084:Col28a1 UTSW 6 8013132 missense possibly damaging 0.49
R4084:Col28a1 UTSW 6 8013131 nonsense probably null
R4417:Col28a1 UTSW 6 8175666 missense possibly damaging 0.62
R4838:Col28a1 UTSW 6 8014559 missense probably benign 0.11
R5752:Col28a1 UTSW 6 8015025 missense possibly damaging 0.79
R5807:Col28a1 UTSW 6 8158144 missense probably benign 0.00
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6046:Col28a1 UTSW 6 8168102 splice site probably null
R6054:Col28a1 UTSW 6 8083748 missense possibly damaging 0.96
R6159:Col28a1 UTSW 6 8162247 intron probably null
R6306:Col28a1 UTSW 6 8014969 missense probably damaging 0.96
R6379:Col28a1 UTSW 6 8012996 missense probably benign 0.00
R6809:Col28a1 UTSW 6 7999468 missense probably damaging 0.99
R7023:Col28a1 UTSW 6 8083763 missense possibly damaging 0.92
R7101:Col28a1 UTSW 6 8014795 missense possibly damaging 0.95
R7117:Col28a1 UTSW 6 8013122 missense possibly damaging 0.89
R7375:Col28a1 UTSW 6 7998499 missense possibly damaging 0.46
Z1177:Col28a1 UTSW 6 8062283 missense possibly damaging 0.52
Z1177:Col28a1 UTSW 6 8127352 missense probably damaging 1.00
Z1177:Col28a1 UTSW 6 8175630 missense unknown
Predicted Primers PCR Primer
(F):5'- CACGTGGTCATGCTGTGATTAAAAG -3'
(R):5'- AAGAGTGCGTTACTGCCGAG -3'

Sequencing Primer
(F):5'- GTCATGCTGTGATTAAAAGTTTCTAG -3'
(R):5'- TGCGTTACTGCCGAGAAGAAAG -3'
Posted On2018-07-23