Incidental Mutation 'R6665:Slc6a6'
ID 526931
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Name solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms Taut
MMRRC Submission 044785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6665 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 91661031-91736044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91703020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185] [ENSMUST00000205480] [ENSMUST00000205828] [ENSMUST00000206545]
AlphaFold O35316
Predicted Effect probably benign
Transcript: ENSMUST00000032185
AA Change: V131A

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: V131A

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205443
Predicted Effect probably benign
Transcript: ENSMUST00000205480
Predicted Effect silent
Transcript: ENSMUST00000205663
Predicted Effect probably benign
Transcript: ENSMUST00000205828
Predicted Effect probably benign
Transcript: ENSMUST00000206545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206835
Meta Mutation Damage Score 0.1752 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,815,775 (GRCm39) probably null Het
Adamts16 T G 13: 70,927,689 (GRCm39) K517Q probably damaging Het
Atp9b A C 18: 80,960,950 (GRCm39) V87G probably benign Het
Avil A G 10: 126,856,394 (GRCm39) K808E probably damaging Het
Bin2 T C 15: 100,554,676 (GRCm39) E49G probably damaging Het
Ccdc146 T C 5: 21,508,092 (GRCm39) Y652C probably damaging Het
Cd6 T C 19: 10,768,367 (GRCm39) N541D probably benign Het
Col28a1 A G 6: 8,062,277 (GRCm39) V671A probably benign Het
Dock6 C T 9: 21,751,208 (GRCm39) C355Y probably damaging Het
Dsc2 A G 18: 20,183,205 (GRCm39) F71S probably damaging Het
Dusp8 G A 7: 141,643,842 (GRCm39) P24S probably damaging Het
Dysf A G 6: 84,107,098 (GRCm39) Y1151C probably benign Het
Fhip2b A T 14: 70,823,078 (GRCm39) L659Q probably damaging Het
Frem2 T C 3: 53,562,077 (GRCm39) Y810C probably damaging Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Hexb T C 13: 97,315,893 (GRCm39) N380D probably benign Het
Ice1 T C 13: 70,751,592 (GRCm39) E1498G possibly damaging Het
Lrif1 T A 3: 106,642,659 (GRCm39) probably null Het
Myo9a G T 9: 59,779,155 (GRCm39) G1637V probably benign Het
Myod1 A T 7: 46,026,281 (GRCm39) H62L probably damaging Het
Myoz3 A C 18: 60,709,495 (GRCm39) L222R probably damaging Het
Naca T A 10: 127,884,227 (GRCm39) N2180K probably damaging Het
Or6c76 T C 10: 129,612,116 (GRCm39) F111S probably damaging Het
Pik3cb A G 9: 98,955,702 (GRCm39) V405A probably benign Het
Prkdc T C 16: 15,603,914 (GRCm39) probably null Het
Rab32 T C 10: 10,433,846 (GRCm39) probably benign Het
Serpinb10 A C 1: 107,474,597 (GRCm39) N253T possibly damaging Het
Slc13a5 C T 11: 72,151,186 (GRCm39) V131I probably damaging Het
Slc25a40 A G 5: 8,502,788 (GRCm39) N290S probably benign Het
Spef2 A T 15: 9,600,604 (GRCm39) probably null Het
Stxbp2 A G 8: 3,691,998 (GRCm39) M547V probably benign Het
Tmem247 A T 17: 87,225,998 (GRCm39) Q146L probably benign Het
Vmn2r67 T C 7: 84,785,900 (GRCm39) I702V probably benign Het
Zmynd15 T C 11: 70,355,636 (GRCm39) S436P probably benign Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91,718,151 (GRCm39) intron probably benign
IGL01829:Slc6a6 APN 6 91,712,170 (GRCm39) missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91,703,050 (GRCm39) missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91,712,160 (GRCm39) missense probably benign
IGL02301:Slc6a6 APN 6 91,703,037 (GRCm39) missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91,726,808 (GRCm39) missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91,725,311 (GRCm39) unclassified probably benign
animas UTSW 6 91,716,995 (GRCm39) splice site probably null
customary UTSW 6 91,703,224 (GRCm39) nonsense probably null
durango UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
habit UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R5861_Slc6a6_905 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R6665_Slc6a6_931 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R0530:Slc6a6 UTSW 6 91,701,939 (GRCm39) missense probably null 0.04
R1327:Slc6a6 UTSW 6 91,703,016 (GRCm39) missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91,717,973 (GRCm39) missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91,718,008 (GRCm39) missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91,701,891 (GRCm39) missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91,712,161 (GRCm39) missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91,703,177 (GRCm39) missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91,712,193 (GRCm39) missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91,718,029 (GRCm39) missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3403:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3978:Slc6a6 UTSW 6 91,732,033 (GRCm39) missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91,718,257 (GRCm39) missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91,703,041 (GRCm39) missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91,712,155 (GRCm39) missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91,721,981 (GRCm39) missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91,700,298 (GRCm39) missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91,731,929 (GRCm39) missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91,716,995 (GRCm39) splice site probably null
R6262:Slc6a6 UTSW 6 91,732,013 (GRCm39) missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91,731,896 (GRCm39) missense probably damaging 0.99
R6998:Slc6a6 UTSW 6 91,729,419 (GRCm39) missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91,718,248 (GRCm39) missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91,701,832 (GRCm39) missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91,716,946 (GRCm39) missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91,718,226 (GRCm39) missense probably benign 0.11
R8125:Slc6a6 UTSW 6 91,703,087 (GRCm39) missense probably damaging 0.97
R8194:Slc6a6 UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R8239:Slc6a6 UTSW 6 91,701,951 (GRCm39) missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91,703,224 (GRCm39) nonsense probably null
R8363:Slc6a6 UTSW 6 91,727,277 (GRCm39) missense probably benign 0.03
R8836:Slc6a6 UTSW 6 91,725,444 (GRCm39) missense probably damaging 0.96
R9102:Slc6a6 UTSW 6 91,731,940 (GRCm39) missense probably benign 0.10
R9257:Slc6a6 UTSW 6 91,716,952 (GRCm39) missense possibly damaging 0.74
R9511:Slc6a6 UTSW 6 91,721,921 (GRCm39) missense probably damaging 1.00
R9526:Slc6a6 UTSW 6 91,726,808 (GRCm39) missense probably benign 0.02
R9701:Slc6a6 UTSW 6 91,700,478 (GRCm39) missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91,700,457 (GRCm39) missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91,718,205 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCATTCAGCCACTTGTCC -3'
(R):5'- ACTCCCAGAACTCGATGACG -3'

Sequencing Primer
(F):5'- AGCCACTTGTCCCTTTATCCAG -3'
(R):5'- TGAAGTTGGCAGTGCTAAGG -3'
Posted On 2018-07-23