Incidental Mutation 'R6665:Hexb'
ID526947
Institutional Source Beutler Lab
Gene Symbol Hexb
Ensembl Gene ENSMUSG00000021665
Gene Namehexosaminidase B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6665 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location97176331-97198357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97179385 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 380 (N380D)
Ref Sequence ENSEMBL: ENSMUSP00000022169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022169] [ENSMUST00000022170] [ENSMUST00000042084] [ENSMUST00000161639] [ENSMUST00000161825]
Predicted Effect probably benign
Transcript: ENSMUST00000022169
AA Change: N380D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000022169
Gene: ENSMUSG00000021665
AA Change: N380D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Glycohydro_20b2 35 157 7.1e-24 PFAM
Pfam:Glyco_hydro_20 179 496 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022170
SMART Domains Protein: ENSMUSP00000022170
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 66 349 9.9e-64 PFAM
Pfam:GTP_EFTU_D2 379 446 4.3e-8 PFAM
low complexity region 447 473 N/A INTRINSIC
Pfam:EFG_II 482 556 3.9e-29 PFAM
EFG_IV 558 677 2.94e-17 SMART
EFG_C 679 766 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042084
SMART Domains Protein: ENSMUSP00000048373
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 324 4.6e-64 PFAM
Pfam:GTP_EFTU_D2 354 421 4.2e-8 PFAM
low complexity region 422 448 N/A INTRINSIC
Pfam:EFG_II 457 531 3.7e-29 PFAM
EFG_IV 533 652 2.94e-17 SMART
EFG_C 654 741 1.9e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160989
Predicted Effect probably benign
Transcript: ENSMUST00000161639
SMART Domains Protein: ENSMUSP00000125656
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 1.2e-68 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 4.5e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 768 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161825
SMART Domains Protein: ENSMUSP00000125088
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 2.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 1.1e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 7.1e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 738 3.46e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222700
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants exhibit spasticity, muscle weakness, rigidity, tremors, and ataxia beginning around 4 months of age and resulting in death about 6 weeks later. Mutants accumulate GM2 ganglioside and glycolipid GA2 in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,904,479 probably null Het
Adamts16 T G 13: 70,779,570 K517Q probably damaging Het
Atp9b A C 18: 80,917,735 V87G probably benign Het
Avil A G 10: 127,020,525 K808E probably damaging Het
Bin2 T C 15: 100,656,795 E49G probably damaging Het
Ccdc146 T C 5: 21,303,094 Y652C probably damaging Het
Cd6 T C 19: 10,791,003 N541D probably benign Het
Col28a1 A G 6: 8,062,277 V671A probably benign Het
Dock6 C T 9: 21,839,912 C355Y probably damaging Het
Dsc2 A G 18: 20,050,148 F71S probably damaging Het
Dusp8 G A 7: 142,090,105 P24S probably damaging Het
Dysf A G 6: 84,130,116 Y1151C probably benign Het
Fam160b2 A T 14: 70,585,638 L659Q probably damaging Het
Frem2 T C 3: 53,654,656 Y810C probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ice1 T C 13: 70,603,473 E1498G possibly damaging Het
Lrif1 T A 3: 106,735,343 probably null Het
Myo9a G T 9: 59,871,872 G1637V probably benign Het
Myod1 A T 7: 46,376,857 H62L probably damaging Het
Myoz3 A C 18: 60,576,423 L222R probably damaging Het
Naca T A 10: 128,048,358 N2180K probably damaging Het
Olfr809 T C 10: 129,776,247 F111S probably damaging Het
Pik3cb A G 9: 99,073,649 V405A probably benign Het
Prkdc T C 16: 15,786,050 probably null Het
Rab32 T C 10: 10,558,102 probably benign Het
Serpinb10 A C 1: 107,546,867 N253T possibly damaging Het
Slc13a5 C T 11: 72,260,360 V131I probably damaging Het
Slc25a40 A G 5: 8,452,788 N290S probably benign Het
Slc6a6 T C 6: 91,726,039 V131A probably benign Het
Spef2 A T 15: 9,600,518 probably null Het
Stxbp2 A G 8: 3,641,998 M547V probably benign Het
Tmem247 A T 17: 86,918,570 Q146L probably benign Het
Vmn2r67 T C 7: 85,136,692 I702V probably benign Het
Zmynd15 T C 11: 70,464,810 S436P probably benign Het
Other mutations in Hexb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Hexb APN 13 97181929 missense probably damaging 1.00
IGL02010:Hexb APN 13 97176845 missense probably benign 0.01
IGL02126:Hexb APN 13 97178024 missense possibly damaging 0.93
IGL02303:Hexb APN 13 97176893 missense probably damaging 1.00
IGL02955:Hexb APN 13 97181076 utr 3 prime probably benign
IGL02988:Hexb UTSW 13 97198221 missense unknown
R0311:Hexb UTSW 13 97183819 unclassified probably benign
R0470:Hexb UTSW 13 97177999 missense probably damaging 0.97
R0520:Hexb UTSW 13 97181110 missense probably benign 0.00
R0893:Hexb UTSW 13 97185627 missense probably benign 0.02
R1869:Hexb UTSW 13 97191259 missense probably benign
R2295:Hexb UTSW 13 97185612 missense probably damaging 1.00
R2884:Hexb UTSW 13 97183700 missense probably damaging 1.00
R4237:Hexb UTSW 13 97176751 intron probably benign
R4238:Hexb UTSW 13 97176751 intron probably benign
R4239:Hexb UTSW 13 97176751 intron probably benign
R4689:Hexb UTSW 13 97181092 missense probably damaging 1.00
R5166:Hexb UTSW 13 97182004 missense probably benign 0.13
R7379:Hexb UTSW 13 97181164 missense probably damaging 1.00
R7553:Hexb UTSW 13 97198173 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGCAGTGAACAGTGAGCC -3'
(R):5'- CTACCTGGACTACACAACATAGCTG -3'

Sequencing Primer
(F):5'- AGTGAACAGTGAGCCCTCCC -3'
(R):5'- CACAACATAGCTGGTTCTATATAGCC -3'
Posted On2018-07-23