Incidental Mutation 'R6665:Fam160b2'
ID526948
Institutional Source Beutler Lab
Gene Symbol Fam160b2
Ensembl Gene ENSMUSG00000022095
Gene Namefamily with sequence similarity 160, member B2
SynonymsRai16, G430067P06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6665 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70583296-70599835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70585638 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 659 (L659Q)
Ref Sequence ENSEMBL: ENSMUSP00000022690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022690] [ENSMUST00000089049] [ENSMUST00000228554]
Predicted Effect probably damaging
Transcript: ENSMUST00000022690
AA Change: L659Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022690
Gene: ENSMUSG00000022095
AA Change: L659Q

DomainStartEndE-ValueType
Pfam:RAI16-like 79 477 7.7e-112 PFAM
low complexity region 516 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089049
SMART Domains Protein: ENSMUSP00000086450
Gene: ENSMUSG00000045211

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:NUDIX 44 165 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228554
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,904,479 probably null Het
Adamts16 T G 13: 70,779,570 K517Q probably damaging Het
Atp9b A C 18: 80,917,735 V87G probably benign Het
Avil A G 10: 127,020,525 K808E probably damaging Het
Bin2 T C 15: 100,656,795 E49G probably damaging Het
Ccdc146 T C 5: 21,303,094 Y652C probably damaging Het
Cd6 T C 19: 10,791,003 N541D probably benign Het
Col28a1 A G 6: 8,062,277 V671A probably benign Het
Dock6 C T 9: 21,839,912 C355Y probably damaging Het
Dsc2 A G 18: 20,050,148 F71S probably damaging Het
Dusp8 G A 7: 142,090,105 P24S probably damaging Het
Dysf A G 6: 84,130,116 Y1151C probably benign Het
Frem2 T C 3: 53,654,656 Y810C probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hexb T C 13: 97,179,385 N380D probably benign Het
Ice1 T C 13: 70,603,473 E1498G possibly damaging Het
Lrif1 T A 3: 106,735,343 probably null Het
Myo9a G T 9: 59,871,872 G1637V probably benign Het
Myod1 A T 7: 46,376,857 H62L probably damaging Het
Myoz3 A C 18: 60,576,423 L222R probably damaging Het
Naca T A 10: 128,048,358 N2180K probably damaging Het
Olfr809 T C 10: 129,776,247 F111S probably damaging Het
Pik3cb A G 9: 99,073,649 V405A probably benign Het
Prkdc T C 16: 15,786,050 probably null Het
Rab32 T C 10: 10,558,102 probably benign Het
Serpinb10 A C 1: 107,546,867 N253T possibly damaging Het
Slc13a5 C T 11: 72,260,360 V131I probably damaging Het
Slc25a40 A G 5: 8,452,788 N290S probably benign Het
Slc6a6 T C 6: 91,726,039 V131A probably benign Het
Spef2 A T 15: 9,600,518 probably null Het
Stxbp2 A G 8: 3,641,998 M547V probably benign Het
Tmem247 A T 17: 86,918,570 Q146L probably benign Het
Vmn2r67 T C 7: 85,136,692 I702V probably benign Het
Zmynd15 T C 11: 70,464,810 S436P probably benign Het
Other mutations in Fam160b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Fam160b2 APN 14 70585373 missense probably damaging 1.00
IGL01862:Fam160b2 APN 14 70587690 missense probably benign 0.03
IGL02306:Fam160b2 APN 14 70588997 missense probably benign
IGL02534:Fam160b2 APN 14 70585688 missense probably damaging 0.98
IGL02534:Fam160b2 APN 14 70586190 missense probably benign
IGL03071:Fam160b2 APN 14 70586209 missense probably damaging 1.00
IGL03162:Fam160b2 APN 14 70587554 missense probably damaging 1.00
IGL03166:Fam160b2 APN 14 70590176 missense probably damaging 1.00
IGL03134:Fam160b2 UTSW 14 70588709 missense possibly damaging 0.66
R0043:Fam160b2 UTSW 14 70588661 missense probably benign 0.45
R0628:Fam160b2 UTSW 14 70587721 missense possibly damaging 0.48
R0691:Fam160b2 UTSW 14 70588287 missense probably damaging 1.00
R1680:Fam160b2 UTSW 14 70586851 missense probably damaging 1.00
R1727:Fam160b2 UTSW 14 70593998 missense probably damaging 0.98
R2059:Fam160b2 UTSW 14 70585049 missense possibly damaging 0.54
R2362:Fam160b2 UTSW 14 70586365 missense probably benign 0.18
R3423:Fam160b2 UTSW 14 70586585 missense probably damaging 1.00
R4233:Fam160b2 UTSW 14 70586878 missense probably damaging 0.99
R4770:Fam160b2 UTSW 14 70588287 missense probably damaging 1.00
R5903:Fam160b2 UTSW 14 70591681 missense probably damaging 1.00
R6217:Fam160b2 UTSW 14 70591758 splice site probably null
R7424:Fam160b2 UTSW 14 70594007 missense probably damaging 1.00
Z1176:Fam160b2 UTSW 14 70586204 missense not run
Z1177:Fam160b2 UTSW 14 70586204 missense not run
Predicted Primers PCR Primer
(F):5'- TGCATTAAGTCACCGATCACC -3'
(R):5'- AGTGCAAACATGCTCAGCCTC -3'

Sequencing Primer
(F):5'- TGCATTAAGTCACCGATCACCTAGAG -3'
(R):5'- AAACATGCTCAGCCTCGGTTG -3'
Posted On2018-07-23