Incidental Mutation 'R6666:Parp1'
ID526957
Institutional Source Beutler Lab
Gene Symbol Parp1
Ensembl Gene ENSMUSG00000026496
Gene Namepoly (ADP-ribose) polymerase family, member 1
SynonymsAdprp, 5830444G22Rik, PARP, sPARP-1, parp-1, Adprt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location180568924-180601254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180585951 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 375 (T375A)
Ref Sequence ENSEMBL: ENSMUSP00000027777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027777]
Predicted Effect probably benign
Transcript: ENSMUST00000027777
AA Change: T375A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027777
Gene: ENSMUSG00000026496
AA Change: T375A

DomainStartEndE-ValueType
zf-PARP 12 90 4.73e-36 SMART
zf-PARP 116 200 3.99e-34 SMART
low complexity region 221 234 N/A INTRINSIC
PADR1 280 333 1.48e-28 SMART
low complexity region 359 378 N/A INTRINSIC
BRCT 388 467 9.62e-7 SMART
low complexity region 494 512 N/A INTRINSIC
WGR 553 633 2.36e-31 SMART
Pfam:PARP_reg 663 794 4e-54 PFAM
Pfam:PARP 797 1007 6.4e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191639
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous ablation of this gene may lead to skin hyperplasia, extreme sensitivity to radiation and alkylating agents, abnormal response to xenobiotics and endogenous compounds, reduced noise-induced hearing loss, altered susceptibility to neurotoxicity,or protection against renal ischemic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Parp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Parp1 APN 1 180589580 missense probably damaging 0.99
IGL01316:Parp1 APN 1 180592935 splice site probably benign
IGL01915:Parp1 APN 1 180598342 missense probably damaging 1.00
IGL02016:Parp1 APN 1 180598951 unclassified probably null
IGL03328:Parp1 APN 1 180599590 splice site probably benign
IGL03348:Parp1 APN 1 180577707 splice site probably benign
IGL03368:Parp1 APN 1 180580622 missense probably benign 0.01
R0541:Parp1 UTSW 1 180599051 missense probably benign 0.05
R0648:Parp1 UTSW 1 180600440 splice site probably benign
R1326:Parp1 UTSW 1 180600458 missense probably damaging 1.00
R1421:Parp1 UTSW 1 180600088 splice site probably benign
R1438:Parp1 UTSW 1 180591242 missense probably benign 0.08
R1781:Parp1 UTSW 1 180588013 missense probably benign 0.04
R1800:Parp1 UTSW 1 180600526 intron probably null
R1900:Parp1 UTSW 1 180597339 missense probably damaging 0.98
R1903:Parp1 UTSW 1 180588670 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2873:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2874:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R4342:Parp1 UTSW 1 180587329 missense probably benign 0.00
R4510:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4511:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4529:Parp1 UTSW 1 180591312 missense probably damaging 1.00
R4740:Parp1 UTSW 1 180589468 missense probably damaging 0.99
R4876:Parp1 UTSW 1 180569035 start codon destroyed probably null 1.00
R6766:Parp1 UTSW 1 180598362 missense probably damaging 1.00
R6918:Parp1 UTSW 1 180588670 missense possibly damaging 0.46
R6974:Parp1 UTSW 1 180589506 nonsense probably null
R6996:Parp1 UTSW 1 180587371 missense possibly damaging 0.46
R7034:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7036:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7068:Parp1 UTSW 1 180588668 missense probably damaging 1.00
R7156:Parp1 UTSW 1 180599064 missense possibly damaging 0.91
R7326:Parp1 UTSW 1 180569100 missense possibly damaging 0.94
R7603:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7733:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7772:Parp1 UTSW 1 180589398 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CCTGGGAACTTTAAGCCTTTCC -3'
(R):5'- ACCTGTTCCATGTTACACTGG -3'

Sequencing Primer
(F):5'- TTTCACAGGACAAATCCCAC -3'
(R):5'- GGTATATAACCTGAACTTGTCCCAAG -3'
Posted On2018-07-23