Incidental Mutation 'R6666:Olfr366'
List |< first << previous [record 33 of 45] next >> last >|
ID526959
Institutional Source Beutler Lab
Gene Symbol Olfr366
Ensembl Gene ENSMUSG00000068947
Gene Nameolfactory receptor 366
SynonymsGA_x6K02T2NLDC-33902472-33903401, MOR138-6, MOR138-5P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37211574-37224506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37220319 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 277 (I277F)
Ref Sequence ENSEMBL: ENSMUSP00000150608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091001] [ENSMUST00000214897]
Predicted Effect probably damaging
Transcript: ENSMUST00000091001
AA Change: I277F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088524
Gene: ENSMUSG00000068947
AA Change: I277F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5e-62 PFAM
Pfam:7tm_1 41 290 3.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214897
AA Change: I277F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Olfr366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Olfr366 APN 2 37220026 missense probably damaging 1.00
IGL01925:Olfr366 APN 2 37220046 missense probably benign 0.14
IGL02355:Olfr366 APN 2 37219669 missense probably damaging 1.00
IGL02362:Olfr366 APN 2 37219669 missense probably damaging 1.00
IGL02671:Olfr366 APN 2 37220245 missense probably damaging 1.00
IGL02821:Olfr366 APN 2 37220100 missense probably damaging 1.00
R0603:Olfr366 UTSW 2 37220106 missense probably damaging 1.00
R0707:Olfr366 UTSW 2 37220196 nonsense probably null
R1204:Olfr366 UTSW 2 37219639 missense probably benign
R1457:Olfr366 UTSW 2 37219659 missense possibly damaging 0.95
R1509:Olfr366 UTSW 2 37219954 missense probably damaging 1.00
R1676:Olfr366 UTSW 2 37219641 nonsense probably null
R1823:Olfr366 UTSW 2 37220332 missense probably damaging 0.96
R2163:Olfr366 UTSW 2 37220077 missense probably damaging 1.00
R2909:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R3696:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R3698:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R4004:Olfr366 UTSW 2 37219948 missense probably benign 0.00
R4655:Olfr366 UTSW 2 37219873 missense probably benign 0.03
R5311:Olfr366 UTSW 2 37219621 missense probably benign 0.00
R5385:Olfr366 UTSW 2 37219587 missense possibly damaging 0.77
R5433:Olfr366 UTSW 2 37219672 missense probably damaging 1.00
R5499:Olfr366 UTSW 2 37219765 missense possibly damaging 0.81
R5707:Olfr366 UTSW 2 37219889 missense probably benign 0.00
R6330:Olfr366 UTSW 2 37220124 missense probably benign 0.00
R6338:Olfr366 UTSW 2 37219822 missense probably damaging 1.00
R6872:Olfr366 UTSW 2 37219977 missense possibly damaging 0.60
R7412:Olfr366 UTSW 2 37219762 missense possibly damaging 0.48
R7789:Olfr366 UTSW 2 37219660 missense probably benign 0.01
R7831:Olfr366 UTSW 2 37219711 missense probably damaging 0.98
R7914:Olfr366 UTSW 2 37219711 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCTGTTGTAATCATGAGCCC -3'
(R):5'- ATTGTCTAGAAACAGACATGCCAC -3'

Sequencing Primer
(F):5'- TGTTGTAATCATGAGCCCTTTTATC -3'
(R):5'- GCCACAAACATAGCAACATGTTGATG -3'
Posted On2018-07-23