Incidental Mutation 'R6666:Olfr1154'
ID526960
Institutional Source Beutler Lab
Gene Symbol Olfr1154
Ensembl Gene ENSMUSG00000075146
Gene Nameolfactory receptor 1154
SynonymsGA_x6K02T2Q125-49403456-49402524, MOR173-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87901256-87905166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87903508 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 56 (H56L)
Ref Sequence ENSEMBL: ENSMUSP00000148909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099844] [ENSMUST00000215017] [ENSMUST00000215862]
Predicted Effect probably damaging
Transcript: ENSMUST00000099844
AA Change: H56L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097432
Gene: ENSMUSG00000075146
AA Change: H56L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.1e-47 PFAM
Pfam:7tm_1 41 289 3.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215017
AA Change: H56L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215862
AA Change: H56L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Olfr1154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Olfr1154 APN 2 87903527 missense probably benign 0.00
IGL01878:Olfr1154 APN 2 87903331 nonsense probably null
IGL02683:Olfr1154 APN 2 87903104 missense possibly damaging 0.80
IGL02836:Olfr1154 APN 2 87903380 missense possibly damaging 0.81
R0432:Olfr1154 UTSW 2 87902960 missense probably damaging 1.00
R1123:Olfr1154 UTSW 2 87902904 missense probably damaging 0.99
R1223:Olfr1154 UTSW 2 87902819 missense probably damaging 0.99
R1561:Olfr1154 UTSW 2 87903161 missense probably benign 0.00
R1964:Olfr1154 UTSW 2 87903667 missense probably benign 0.00
R2041:Olfr1154 UTSW 2 87902797 missense probably damaging 1.00
R2219:Olfr1154 UTSW 2 87902925 nonsense probably null
R2233:Olfr1154 UTSW 2 87903475 missense probably damaging 1.00
R3719:Olfr1154 UTSW 2 87903103 missense probably benign 0.05
R4826:Olfr1154 UTSW 2 87903349 missense probably damaging 1.00
R4908:Olfr1154 UTSW 2 87903189 missense probably damaging 1.00
R5056:Olfr1154 UTSW 2 87903571 missense probably damaging 1.00
R5589:Olfr1154 UTSW 2 87903347 missense probably benign 0.26
R6477:Olfr1154 UTSW 2 87902990 missense probably damaging 1.00
R6532:Olfr1154 UTSW 2 87903202 missense probably damaging 1.00
R6693:Olfr1154 UTSW 2 87903308 missense probably damaging 1.00
R6724:Olfr1154 UTSW 2 87903602 missense probably benign 0.00
R7784:Olfr1154 UTSW 2 87903193 missense probably benign 0.01
R8099:Olfr1154 UTSW 2 87903508 missense probably damaging 1.00
R8168:Olfr1154 UTSW 2 87903199 missense probably damaging 0.97
Z1088:Olfr1154 UTSW 2 87903584 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATGTACCTGTCATAAGCCATGGC -3'
(R):5'- GGGCTACAGAAACCAAAATTTCTAC -3'

Sequencing Primer
(F):5'- CAGCCAAAAGGAAAGATTCTGTATC -3'
(R):5'- TTCTACAAATAATGAGTGTGGAGAAC -3'
Posted On2018-07-23