Incidental Mutation 'R6666:Capza1'
ID526962
Institutional Source Beutler Lab
Gene Symbol Capza1
Ensembl Gene ENSMUSG00000070372
Gene Namecapping protein (actin filament) muscle Z-line, alpha 1
SynonymsCappa1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location104822779-104864505 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 104828606 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094028]
Predicted Effect probably null
Transcript: ENSMUST00000094028
SMART Domains Protein: ENSMUSP00000102381
Gene: ENSMUSG00000070372

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 14 282 3.1e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197199
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CAPZA1 is a member of the F-actin capping protein alpha subunit family. This gene encodes the alpha subunit of the barbed-end actin binding protein. The protein regulates growth of the actin filament by capping the barbed end of growing actin filaments. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Capza1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Capza1 APN 3 104864371 missense possibly damaging 0.75
R1678:Capza1 UTSW 3 104864353 nonsense probably null
R1887:Capza1 UTSW 3 104839780 critical splice donor site probably null
R4059:Capza1 UTSW 3 104825111 missense probably damaging 0.98
R4650:Capza1 UTSW 3 104844980 missense probably damaging 1.00
R5030:Capza1 UTSW 3 104840838 missense probably damaging 1.00
R7293:Capza1 UTSW 3 104840835 missense probably benign
R7748:Capza1 UTSW 3 104825405 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAAGACATGACAACCACCTTTAGTC -3'
(R):5'- AGTAATTTGCCTCTGCTAATGAGAG -3'

Sequencing Primer
(F):5'- GTAAGCACACTGTAGCTGTCTTCAG -3'
(R):5'- TGCCTCTGCTAATGAGAGATTTC -3'
Posted On2018-07-23