Incidental Mutation 'R6666:Wfs1'
ID526966
Institutional Source Beutler Lab
Gene Symbol Wfs1
Ensembl Gene ENSMUSG00000039474
Gene Namewolframin ER transmembrane glycoprotein
Synonymswolframin
MMRRC Submission
Accession Numbers

Genbank: NM_011716; MGI: 1328355

Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location36966104-36989205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36967619 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 567 (T567A)
Ref Sequence ENSEMBL: ENSMUSP00000132404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043964] [ENSMUST00000166339]
Predicted Effect probably benign
Transcript: ENSMUST00000043964
AA Change: T643A

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048053
Gene: ENSMUSG00000039474
AA Change: T643A

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 1e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
transmembrane domain 313 335 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
transmembrane domain 495 517 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 561 583 N/A INTRINSIC
transmembrane domain 590 612 N/A INTRINSIC
transmembrane domain 632 654 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166339
AA Change: T567A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132404
Gene: ENSMUSG00000039474
AA Change: T567A

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 3e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 556 578 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167937
SMART Domains Protein: ENSMUSP00000125779
Gene: ENSMUSG00000039474

DomainStartEndE-ValueType
Blast:SEL1 20 58 4e-9 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased pancreatic beta cells and impaired glucose tolerance. Mice homozygous for a knock-out allele exhibit impaired glucose tolerance, decreased body weight, and abnormal behavior associated with increased sensitivity to stress. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Wfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Wfs1 APN 5 36967917 nonsense probably null
IGL01391:Wfs1 APN 5 36971563 missense probably benign 0.10
IGL01788:Wfs1 APN 5 36968636 missense probably benign 0.01
IGL02169:Wfs1 APN 5 36968479 missense probably damaging 0.99
IGL02814:Wfs1 APN 5 36967669 missense possibly damaging 0.88
IGL03294:Wfs1 APN 5 36975597 missense probably damaging 1.00
IGL03299:Wfs1 APN 5 36968387 nonsense probably null
2107:Wfs1 UTSW 5 36967273 missense probably damaging 1.00
R0077:Wfs1 UTSW 5 36973194 missense probably damaging 1.00
R0180:Wfs1 UTSW 5 36967028 missense probably damaging 0.96
R0402:Wfs1 UTSW 5 36976980 unclassified probably benign
R0458:Wfs1 UTSW 5 36968669 missense probably damaging 0.98
R0533:Wfs1 UTSW 5 36973722 splice site probably benign
R0890:Wfs1 UTSW 5 36975544 missense probably damaging 1.00
R0948:Wfs1 UTSW 5 36967561 missense probably damaging 1.00
R1413:Wfs1 UTSW 5 36982078 missense possibly damaging 0.65
R1759:Wfs1 UTSW 5 36967015 missense probably damaging 0.99
R2009:Wfs1 UTSW 5 36968309 missense probably damaging 0.96
R2137:Wfs1 UTSW 5 36967501 missense probably damaging 0.99
R2157:Wfs1 UTSW 5 36967942 missense probably damaging 1.00
R2216:Wfs1 UTSW 5 36967220 nonsense probably null
R3779:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3850:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3853:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3918:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R4093:Wfs1 UTSW 5 36967465 missense probably damaging 0.97
R5056:Wfs1 UTSW 5 36975587 missense probably benign 0.00
R5849:Wfs1 UTSW 5 36973264 missense probably damaging 1.00
R5997:Wfs1 UTSW 5 36967750 missense probably damaging 0.99
R7024:Wfs1 UTSW 5 36966950 missense probably damaging 1.00
R7157:Wfs1 UTSW 5 36967172 missense probably benign 0.00
R7264:Wfs1 UTSW 5 36967846 missense probably damaging 1.00
R7269:Wfs1 UTSW 5 36967790 nonsense probably null
R7365:Wfs1 UTSW 5 36967732 missense probably benign 0.33
R7657:Wfs1 UTSW 5 36968234 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCACTGTTGTCGATCTCG -3'
(R):5'- TGCAGTTTGCCCGATGGTTC -3'

Sequencing Primer
(F):5'- GTCACTCGGACATACTTGAAGCG -3'
(R):5'- ATGGTTCCTGTCGCTGGACC -3'
Posted On2018-07-23