Incidental Mutation 'R6666:Cplx1'
List |< first << previous [record 6 of 45] next >> last >|
ID526968
Institutional Source Beutler Lab
Gene Symbol Cplx1
Ensembl Gene ENSMUSG00000033615
Gene Namecomplexin 1
Synonyms921-S
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108518554-108550024 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 108520165 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 123 (Y123*)
Ref Sequence ENSEMBL: ENSMUSP00000038502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046892] [ENSMUST00000129040]
Predicted Effect probably null
Transcript: ENSMUST00000046892
AA Change: Y123*
SMART Domains Protein: ENSMUSP00000038502
Gene: ENSMUSG00000033615
AA Change: Y123*

DomainStartEndE-ValueType
Pfam:Synaphin 1 133 2.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129040
SMART Domains Protein: ENSMUSP00000118118
Gene: ENSMUSG00000033615

DomainStartEndE-ValueType
Pfam:Synaphin 1 77 2.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136334
Meta Mutation Damage Score 0.9701 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins encoded by the complexin/synaphin gene family are cytosolic proteins that function in synaptic vesicle exocytosis. These proteins bind syntaxin, part of the SNAP receptor. The protein product of this gene binds to the SNAP receptor complex and disrupts it, allowing transmitter release. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene suffer from ataxia, are unable to reproduce, and die within 2-4 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Cplx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Cplx1 APN 5 108548527 splice site probably null
IGL02588:Cplx1 APN 5 108525423 missense possibly damaging 0.71
hillbilly UTSW 5 108520165 nonsense probably null
R1227:Cplx1 UTSW 5 108525396 missense possibly damaging 0.92
R7002:Cplx1 UTSW 5 108520316 missense probably damaging 0.98
R7074:Cplx1 UTSW 5 108548527 splice site probably null
R7618:Cplx1 UTSW 5 108525529 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCAGGATAGATCTAGGACTATGGC -3'
(R):5'- TTACATCAGTGCCACCCAGG -3'

Sequencing Primer
(F):5'- ATCTAGGACTATGGCTTATTTTTGC -3'
(R):5'- TATGCAAGCCCCGCCTTG -3'
Posted On2018-07-23