Incidental Mutation 'R6666:Kdm3a'
ID526970
Institutional Source Beutler Lab
Gene Symbol Kdm3a
Ensembl Gene ENSMUSG00000053470
Gene Namelysine (K)-specific demethylase 3A
SynonymsC230043E16Rik, Jmjd1a, Tsga, 1700105C21Rik, Jmjd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71588972-71632990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71611990 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 345 (E345G)
Ref Sequence ENSEMBL: ENSMUSP00000145719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065509] [ENSMUST00000167220] [ENSMUST00000205289] [ENSMUST00000207023]
Predicted Effect probably benign
Transcript: ENSMUST00000065509
AA Change: E345G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065716
Gene: ENSMUSG00000053470
AA Change: E345G

DomainStartEndE-ValueType
low complexity region 853 859 N/A INTRINSIC
JmjC 1060 1283 1.6e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167220
AA Change: E345G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128789
Gene: ENSMUSG00000053470
AA Change: E345G

DomainStartEndE-ValueType
low complexity region 853 859 N/A INTRINSIC
JmjC 1060 1283 1.6e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205289
AA Change: E345G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206704
Predicted Effect unknown
Transcript: ENSMUST00000206916
AA Change: E5G
Predicted Effect probably benign
Transcript: ENSMUST00000207023
AA Change: E345G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein that contains a jumonji domain and may play a role in hormone-dependent transcriptional activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Male mice homozygous for a hypomorphic allele display infertility, oligoasthenoteratozoospermia, small testis, and impaired spermiogenesis. Mice homozygous for a null allele exhibit abnormal spermatogenesis and obesity associated with hyperlipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Kdm3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Kdm3a APN 6 71600117 missense probably damaging 1.00
IGL02219:Kdm3a APN 6 71600734 missense probably benign 0.01
IGL02423:Kdm3a APN 6 71614003 splice site probably benign
IGL02427:Kdm3a APN 6 71592200 splice site probably benign
IGL02519:Kdm3a APN 6 71611586 missense probably benign 0.04
IGL03143:Kdm3a APN 6 71596861 missense probably damaging 0.98
IGL03279:Kdm3a APN 6 71611675 missense probably benign
R0194:Kdm3a UTSW 6 71624594 missense probably null 0.44
R0408:Kdm3a UTSW 6 71611679 missense probably benign 0.00
R0426:Kdm3a UTSW 6 71600755 missense probably damaging 1.00
R0608:Kdm3a UTSW 6 71620046 missense probably benign 0.01
R1175:Kdm3a UTSW 6 71600027 missense possibly damaging 0.94
R1835:Kdm3a UTSW 6 71613956 missense probably benign 0.14
R3821:Kdm3a UTSW 6 71611677 missense probably benign 0.00
R5083:Kdm3a UTSW 6 71621362 missense probably damaging 1.00
R5536:Kdm3a UTSW 6 71611936 missense probably benign 0.31
R5903:Kdm3a UTSW 6 71632250 start gained probably benign
R5965:Kdm3a UTSW 6 71621380 missense probably benign 0.21
R6236:Kdm3a UTSW 6 71611657 missense probably benign 0.00
R6541:Kdm3a UTSW 6 71594533 missense possibly damaging 0.69
R7090:Kdm3a UTSW 6 71595545 missense possibly damaging 0.69
R7112:Kdm3a UTSW 6 71632170 missense probably benign
R7136:Kdm3a UTSW 6 71611780 missense probably benign 0.00
R7163:Kdm3a UTSW 6 71632077 missense probably damaging 1.00
R7608:Kdm3a UTSW 6 71600747 missense probably benign 0.01
R7614:Kdm3a UTSW 6 71591953 missense possibly damaging 0.82
R7683:Kdm3a UTSW 6 71599454 missense probably benign
R7687:Kdm3a UTSW 6 71599492 missense possibly damaging 0.64
R7868:Kdm3a UTSW 6 71595489 missense probably benign 0.31
R7951:Kdm3a UTSW 6 71595489 missense probably benign 0.31
RF053:Kdm3a UTSW 6 71632049 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- GTCTGCTCTCCTGATCAGTG -3'
(R):5'- CAGGGAACGTGTAGGATTGC -3'

Sequencing Primer
(F):5'- CTCCTGATCAGTGTTTGTTTTAGGC -3'
(R):5'- GTGTAAGATACTTTTCTCAACCCCAG -3'
Posted On2018-07-23