Incidental Mutation 'R6666:Scnn1g'
List |< first << previous [record 38 of 45] next >> last >|
ID526977
Institutional Source Beutler Lab
Gene Symbol Scnn1g
Ensembl Gene ENSMUSG00000000216
Gene Namesodium channel, nonvoltage-gated 1 gamma
SynonymsENaC gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.674) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location121734479-121768475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121767388 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 603 (D603N)
Ref Sequence ENSEMBL: ENSMUSP00000000221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000221]
Predicted Effect probably benign
Transcript: ENSMUST00000000221
AA Change: D603N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: D603N

DomainStartEndE-ValueType
Pfam:ASC 32 558 6.4e-91 PFAM
low complexity region 618 631 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Scnn1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Scnn1g APN 7 121740437 missense probably benign 0.00
IGL01824:Scnn1g APN 7 121766293 missense probably benign 0.00
IGL02133:Scnn1g APN 7 121743699 missense probably damaging 1.00
IGL02529:Scnn1g APN 7 121742446 splice site probably benign
IGL02814:Scnn1g APN 7 121740365 missense probably damaging 1.00
IGL03091:Scnn1g APN 7 121746683 missense probably damaging 1.00
IGL03253:Scnn1g APN 7 121737933 nonsense probably null
PIT4504001:Scnn1g UTSW 7 121742331 missense probably benign 0.30
R0230:Scnn1g UTSW 7 121746761 splice site probably benign
R0324:Scnn1g UTSW 7 121740555 missense possibly damaging 0.62
R0367:Scnn1g UTSW 7 121746579 splice site probably benign
R0534:Scnn1g UTSW 7 121767424 missense probably benign 0.00
R1747:Scnn1g UTSW 7 121760463 missense probably damaging 0.99
R2004:Scnn1g UTSW 7 121738188 nonsense probably null
R2197:Scnn1g UTSW 7 121767296 missense probably damaging 1.00
R4396:Scnn1g UTSW 7 121740427 missense probably benign 0.01
R4804:Scnn1g UTSW 7 121763080 frame shift probably null
R4805:Scnn1g UTSW 7 121746602 missense probably damaging 1.00
R5219:Scnn1g UTSW 7 121766266 missense probably damaging 1.00
R5757:Scnn1g UTSW 7 121738215 missense probably damaging 1.00
R5882:Scnn1g UTSW 7 121767358 missense possibly damaging 0.79
R5910:Scnn1g UTSW 7 121738095 missense probably damaging 0.99
R6381:Scnn1g UTSW 7 121767499 missense probably benign 0.00
R6735:Scnn1g UTSW 7 121742263 missense probably benign 0.02
R6813:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6860:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6887:Scnn1g UTSW 7 121760444 missense probably benign 0.01
R7289:Scnn1g UTSW 7 121738081 nonsense probably null
R7488:Scnn1g UTSW 7 121763434 missense probably benign 0.00
R7630:Scnn1g UTSW 7 121760481 missense probably damaging 1.00
R7888:Scnn1g UTSW 7 121743655 missense probably damaging 0.97
R7971:Scnn1g UTSW 7 121743655 missense probably damaging 0.97
Z1177:Scnn1g UTSW 7 121760475 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAACTTTGGTGGACAGCTCGG -3'
(R):5'- GAGTCTCCTCAAACCATGACTG -3'

Sequencing Primer
(F):5'- CCTGTGGATGAGCTGCTC -3'
(R):5'- AAACCATGACTGTTTTCCAATCC -3'
Posted On2018-07-23