Incidental Mutation 'R6666:Trmt1'
ID526979
Institutional Source Beutler Lab
Gene Symbol Trmt1
Ensembl Gene ENSMUSG00000001909
Gene NametRNA methyltransferase 1
SynonymsD8Ertd812e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R6666 (G1)
Quality Score133.008
Status Validated
Chromosome8
Chromosomal Location84686307-84699808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84698454 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 493 (L493P)
Ref Sequence ENSEMBL: ENSMUSP00000135510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001974] [ENSMUST00000037165] [ENSMUST00000109767] [ENSMUST00000109768] [ENSMUST00000125370] [ENSMUST00000131700] [ENSMUST00000143427] [ENSMUST00000152301] [ENSMUST00000175784] [ENSMUST00000177084] [ENSMUST00000177423]
Predicted Effect probably damaging
Transcript: ENSMUST00000001974
AA Change: L522P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001974
Gene: ENSMUSG00000001909
AA Change: L522P

DomainStartEndE-ValueType
Pfam:TRM 55 499 3.5e-151 PFAM
Pfam:Met_10 141 256 1.3e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037165
SMART Domains Protein: ENSMUSP00000046010
Gene: ENSMUSG00000034041

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
HLH 155 207 3.97e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109767
AA Change: L522P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105389
Gene: ENSMUSG00000001909
AA Change: L522P

DomainStartEndE-ValueType
Pfam:TRM 55 499 4.9e-149 PFAM
Pfam:Met_10 142 256 3.4e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109768
AA Change: L515P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105390
Gene: ENSMUSG00000001909
AA Change: L515P

DomainStartEndE-ValueType
Pfam:TRM 48 492 3.1e-149 PFAM
Pfam:Met_10 135 249 4.4e-8 PFAM
ZnF_C3H1 592 618 3.55e-6 SMART
low complexity region 641 654 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125370
AA Change: L493P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135510
Gene: ENSMUSG00000001909
AA Change: L493P

DomainStartEndE-ValueType
Pfam:TRM 55 470 1.7e-140 PFAM
Pfam:Met_10 142 256 2.8e-8 PFAM
ZnF_C3H1 570 596 3.55e-6 SMART
low complexity region 619 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128022
Predicted Effect probably benign
Transcript: ENSMUST00000131700
SMART Domains Protein: ENSMUSP00000122526
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 108 3.9e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000136423
AA Change: L19P
SMART Domains Protein: ENSMUSP00000134723
Gene: ENSMUSG00000001909
AA Change: L19P

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138300
Predicted Effect probably benign
Transcript: ENSMUST00000143427
SMART Domains Protein: ENSMUSP00000117140
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 47 98 3.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148644
Predicted Effect probably benign
Transcript: ENSMUST00000152301
SMART Domains Protein: ENSMUSP00000116712
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 242 4.2e-49 PFAM
Pfam:Met_10 145 229 2.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175767
Predicted Effect probably benign
Transcript: ENSMUST00000175784
SMART Domains Protein: ENSMUSP00000135273
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 221 8.6e-39 PFAM
Pfam:Met_10 144 221 5.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175884
Predicted Effect probably benign
Transcript: ENSMUST00000177084
SMART Domains Protein: ENSMUSP00000135675
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 29 260 4.1e-76 PFAM
Pfam:Met_10 117 231 4.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177286
Predicted Effect probably benign
Transcript: ENSMUST00000177423
SMART Domains Protein: ENSMUSP00000135327
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 47 262 1.4e-66 PFAM
Pfam:Met_10 138 252 5.6e-9 PFAM
Meta Mutation Damage Score 0.9454 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Trmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Trmt1 APN 8 84695509 missense possibly damaging 0.92
IGL01959:Trmt1 APN 8 84691376 unclassified probably null
IGL02127:Trmt1 APN 8 84697471 missense probably damaging 1.00
IGL02689:Trmt1 APN 8 84699756 unclassified probably benign
IGL03087:Trmt1 APN 8 84695233 missense probably damaging 1.00
IGL02835:Trmt1 UTSW 8 84696960 missense probably null 1.00
PIT4418001:Trmt1 UTSW 8 84697670 missense probably damaging 0.97
R0395:Trmt1 UTSW 8 84697112 splice site probably null
R0964:Trmt1 UTSW 8 84696852 missense probably damaging 1.00
R1881:Trmt1 UTSW 8 84689267 intron probably benign
R2190:Trmt1 UTSW 8 84689841 nonsense probably null
R2197:Trmt1 UTSW 8 84690858 missense probably damaging 1.00
R2979:Trmt1 UTSW 8 84696882 missense probably damaging 1.00
R3813:Trmt1 UTSW 8 84695217 unclassified probably benign
R4407:Trmt1 UTSW 8 84697755 unclassified probably benign
R4461:Trmt1 UTSW 8 84699149 missense probably benign 0.01
R4588:Trmt1 UTSW 8 84690753 intron probably benign
R5170:Trmt1 UTSW 8 84695232 missense probably damaging 1.00
R6299:Trmt1 UTSW 8 84697290 nonsense probably null
R6614:Trmt1 UTSW 8 84689333 missense probably benign
R7669:Trmt1 UTSW 8 84697551 missense probably benign 0.05
Z1176:Trmt1 UTSW 8 84698240 missense possibly damaging 0.95
Z1176:Trmt1 UTSW 8 84699198 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTGAAGACAGATGCTCCCC -3'
(R):5'- CTGACTCAGATACTCACACGTATG -3'

Sequencing Primer
(F):5'- CCTCTGGGACATCATGCGTTG -3'
(R):5'- CACGTATGTGTGACTCAAGAAC -3'
Posted On2018-07-23