Incidental Mutation 'R6666:Limk2'
List |< first << previous [record 22 of 45] next >> last >|
ID526983
Institutional Source Beutler Lab
Gene Symbol Limk2
Ensembl Gene ENSMUSG00000020451
Gene NameLIM motif-containing protein kinase 2
SynonymsLimk2a, A930024P04Rik, LIM kinase 2, Limk2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location3344256-3409189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3360493 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 49 (E49D)
Ref Sequence ENSEMBL: ENSMUSP00000099165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101638] [ENSMUST00000101640] [ENSMUST00000101642] [ENSMUST00000110029]
Predicted Effect probably damaging
Transcript: ENSMUST00000101638
AA Change: E70D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099162
Gene: ENSMUSG00000020451
AA Change: E70D

DomainStartEndE-ValueType
LIM 11 63 2e-14 SMART
LIM 71 124 4.63e-10 SMART
PDZ 161 239 7.04e-10 SMART
low complexity region 241 255 N/A INTRINSIC
low complexity region 280 306 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
Pfam:Pkinase 331 600 5.3e-48 PFAM
Pfam:Pkinase_Tyr 331 601 4.7e-50 PFAM
Pfam:Kdo 341 497 8.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101640
AA Change: E49D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099163
Gene: ENSMUSG00000020451
AA Change: E49D

DomainStartEndE-ValueType
LIM 7 42 4.91e-1 SMART
LIM 50 103 4.63e-10 SMART
PDZ 140 218 7.04e-10 SMART
low complexity region 220 234 N/A INTRINSIC
low complexity region 259 285 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
Pfam:Pkinase 310 582 1.2e-45 PFAM
Pfam:Pkinase_Tyr 310 586 1.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101642
AA Change: E49D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099165
Gene: ENSMUSG00000020451
AA Change: E49D

DomainStartEndE-ValueType
LIM 7 42 4.91e-1 SMART
LIM 50 103 4.63e-10 SMART
PDZ 140 218 7.04e-10 SMART
low complexity region 220 234 N/A INTRINSIC
low complexity region 259 285 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
Pfam:Pkinase 310 579 4.9e-48 PFAM
Pfam:Pkinase_Tyr 310 580 4.3e-50 PFAM
Pfam:Kdo 320 476 8.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110029
SMART Domains Protein: ENSMUSP00000105656
Gene: ENSMUSG00000020451

DomainStartEndE-ValueType
PDZ 1 52 4.55e-1 SMART
low complexity region 54 68 N/A INTRINSIC
low complexity region 93 119 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Pfam:Pkinase 144 411 2.7e-49 PFAM
Pfam:Pkinase_Tyr 144 414 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148091
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are approximately 40 known eukaryotic LIM proteins, so named for the LIM domains they contain. LIM domains are highly conserved cysteine-rich structures containing 2 zinc fingers. Although zinc fingers usually function by binding to DNA or RNA, the LIM motif probably mediates protein-protein interactions. LIM kinase-1 and LIM kinase-2 belong to a small subfamily with a unique combination of 2 N-terminal LIM motifs and a C-terminal protein kinase domain. The protein encoded by this gene is phosphorylated and activated by ROCK, a downstream effector of Rho, and the encoded protein, in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. It is thought that this pathway contributes to Rho-induced reorganization of the actin cytoskeleton. At least three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygotes for targeted null mutations exhibit small testes but are fertile. Mutant kidneys have fewer glomeruli and dilated renal tubules, but function normally. Mice homozygous for a gene trap allele or spontaneous mutation have open eyelids at birth, corneal abnormalities and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Limk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Limk2 APN 11 3355475 splice site probably benign
IGL01592:Limk2 APN 11 3359052 missense probably benign 0.00
IGL01716:Limk2 APN 11 3358990 splice site probably null
IGL01911:Limk2 APN 11 3355340 missense probably benign
R0900:Limk2 UTSW 11 3350731 missense probably damaging 1.00
R1587:Limk2 UTSW 11 3353455 missense possibly damaging 0.82
R1632:Limk2 UTSW 11 3346250 missense probably damaging 1.00
R1695:Limk2 UTSW 11 3353275 critical splice donor site probably null
R1712:Limk2 UTSW 11 3358104 splice site probably null
R1792:Limk2 UTSW 11 3358236 missense probably benign
R1982:Limk2 UTSW 11 3355461 missense probably benign 0.00
R3009:Limk2 UTSW 11 3359046 missense probably benign 0.01
R4565:Limk2 UTSW 11 3348634 missense probably damaging 0.98
R4703:Limk2 UTSW 11 3347586 nonsense probably null
R4978:Limk2 UTSW 11 3409069 utr 5 prime probably benign
R5160:Limk2 UTSW 11 3350772 missense probably damaging 1.00
R5460:Limk2 UTSW 11 3352332 missense probably benign 0.30
R6497:Limk2 UTSW 11 3360492 missense probably benign 0.00
R6543:Limk2 UTSW 11 3350682 missense probably damaging 1.00
R7054:Limk2 UTSW 11 3355448 missense possibly damaging 0.95
R7330:Limk2 UTSW 11 3346311 missense probably benign 0.39
R7681:Limk2 UTSW 11 3353354 missense probably damaging 0.96
R7722:Limk2 UTSW 11 3356092 utr 5 prime probably null
R7745:Limk2 UTSW 11 3355896 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTCTCACAGATAGTCCTCTGG -3'
(R):5'- ATTAAACTGGGAGCCAAGCAC -3'

Sequencing Primer
(F):5'- CTAGACCTGTCTTTAGTAAGGGCTC -3'
(R):5'- AGCCAAGCACCCCTGTG -3'
Posted On2018-07-23