Incidental Mutation 'R6666:Myh4'
ID526984
Institutional Source Beutler Lab
Gene Symbol Myh4
Ensembl Gene ENSMUSG00000057003
Gene Namemyosin, heavy polypeptide 4, skeletal muscle
SynonymsMM, Minimsc, MYH-2B, MyHC-IIb, Minmus, MHC2B, Myhsf
MMRRC Submission
Accession Numbers

Genbank: NM_010855; MGI: 1339713

Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67238029-67260446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67251812 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 933 (E933G)
Ref Sequence ENSEMBL: ENSMUSP00000127514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018632] [ENSMUST00000170942]
Predicted Effect probably damaging
Transcript: ENSMUST00000018632
AA Change: E933G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018632
Gene: ENSMUSG00000057003
AA Change: E933G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 4.7e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
Pfam:Myosin_tail_1 847 1928 2.5e-168 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170942
AA Change: E933G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127514
Gene: ENSMUSG00000057003
AA Change: E933G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-15 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
low complexity region 928 942 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit decreased growth and muscle defects including reduced muscle mass, muscle fiber loss, compensatory fiber hypertrophy, and impaired strength. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Myh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Myh4 APN 11 67255379 missense probably damaging 1.00
IGL01600:Myh4 APN 11 67260189 missense possibly damaging 0.85
IGL01737:Myh4 APN 11 67243419 splice site probably benign
IGL02208:Myh4 APN 11 67251934 missense possibly damaging 0.96
IGL02334:Myh4 APN 11 67245547 missense probably damaging 1.00
IGL02376:Myh4 APN 11 67245728 missense probably benign 0.00
IGL02429:Myh4 APN 11 67258982 nonsense probably null
IGL02450:Myh4 APN 11 67251809 missense probably damaging 1.00
IGL02524:Myh4 APN 11 67249240 missense possibly damaging 0.79
IGL02612:Myh4 APN 11 67256479 missense probably benign
IGL03024:Myh4 APN 11 67248479 missense probably damaging 1.00
IGL03065:Myh4 APN 11 67259156 missense probably benign 0.12
IGL03084:Myh4 APN 11 67251951 splice site probably null
IGL03188:Myh4 APN 11 67246543 critical splice donor site probably null
IGL03204:Myh4 APN 11 67250296 missense possibly damaging 0.63
IGL03252:Myh4 APN 11 67252216 missense probably damaging 0.99
IGL03345:Myh4 APN 11 67255478 missense probably damaging 1.00
F6893:Myh4 UTSW 11 67255457 missense probably null 0.12
PIT1430001:Myh4 UTSW 11 67258832 missense probably benign 0.01
PIT4458001:Myh4 UTSW 11 67240995 missense possibly damaging 0.56
R0099:Myh4 UTSW 11 67259347 missense probably benign
R0194:Myh4 UTSW 11 67252336 missense probably damaging 1.00
R0346:Myh4 UTSW 11 67260326 missense probably benign
R0427:Myh4 UTSW 11 67258653 missense probably damaging 0.98
R0483:Myh4 UTSW 11 67252297 missense probably damaging 1.00
R0571:Myh4 UTSW 11 67250331 missense possibly damaging 0.91
R0854:Myh4 UTSW 11 67259147 missense possibly damaging 0.90
R0940:Myh4 UTSW 11 67242863 missense probably damaging 1.00
R0946:Myh4 UTSW 11 67251751 missense possibly damaging 0.70
R1108:Myh4 UTSW 11 67255706 missense probably null 0.01
R1162:Myh4 UTSW 11 67258613 missense probably damaging 0.97
R1194:Myh4 UTSW 11 67255734 critical splice donor site probably null
R1347:Myh4 UTSW 11 67244741 splice site probably benign
R1457:Myh4 UTSW 11 67248461 missense probably damaging 0.99
R1531:Myh4 UTSW 11 67250540 missense probably benign 0.01
R1716:Myh4 UTSW 11 67250309 missense possibly damaging 0.92
R1766:Myh4 UTSW 11 67256295 missense possibly damaging 0.61
R1796:Myh4 UTSW 11 67260324 missense probably benign
R1856:Myh4 UTSW 11 67255682 missense probably damaging 1.00
R1873:Myh4 UTSW 11 67254743 missense probably benign 0.16
R2069:Myh4 UTSW 11 67246366 splice site probably benign
R2370:Myh4 UTSW 11 67255628 missense probably damaging 1.00
R2406:Myh4 UTSW 11 67259174 missense probably damaging 1.00
R2414:Myh4 UTSW 11 67250768 missense probably benign 0.01
R2848:Myh4 UTSW 11 67248633 missense probably benign 0.20
R3111:Myh4 UTSW 11 67246450 missense possibly damaging 0.86
R3744:Myh4 UTSW 11 67255315 missense probably damaging 1.00
R3845:Myh4 UTSW 11 67259105 missense possibly damaging 0.90
R3877:Myh4 UTSW 11 67257183 missense probably benign 0.00
R4498:Myh4 UTSW 11 67251752 missense probably damaging 1.00
R4514:Myh4 UTSW 11 67255569 missense probably benign 0.06
R4601:Myh4 UTSW 11 67250310 missense possibly damaging 0.94
R4673:Myh4 UTSW 11 67246401 missense probably benign 0.02
R4684:Myh4 UTSW 11 67245811 missense probably damaging 0.99
R4736:Myh4 UTSW 11 67240920 missense probably benign 0.01
R4837:Myh4 UTSW 11 67258992 missense probably benign 0.38
R4866:Myh4 UTSW 11 67248627 missense probably benign 0.00
R4869:Myh4 UTSW 11 67252664 missense probably damaging 1.00
R4887:Myh4 UTSW 11 67241054 missense probably damaging 0.99
R4921:Myh4 UTSW 11 67254028 missense probably damaging 1.00
R5005:Myh4 UTSW 11 67253415 missense probably benign 0.05
R5008:Myh4 UTSW 11 67253532 missense probably benign 0.00
R5011:Myh4 UTSW 11 67256363 missense probably benign 0.03
R5087:Myh4 UTSW 11 67255409 missense probably damaging 1.00
R5277:Myh4 UTSW 11 67252354 missense probably damaging 1.00
R5336:Myh4 UTSW 11 67259191 splice site probably null
R5354:Myh4 UTSW 11 67255725 missense possibly damaging 0.69
R5371:Myh4 UTSW 11 67259324 missense probably damaging 1.00
R5484:Myh4 UTSW 11 67251818 missense probably damaging 1.00
R5774:Myh4 UTSW 11 67253208 nonsense probably null
R5902:Myh4 UTSW 11 67250907 missense possibly damaging 0.69
R5941:Myh4 UTSW 11 67259300 missense probably damaging 0.99
R6045:Myh4 UTSW 11 67244724 missense probably benign 0.32
R6156:Myh4 UTSW 11 67250792 missense probably benign 0.00
R6301:Myh4 UTSW 11 67255333 missense possibly damaging 0.95
R6318:Myh4 UTSW 11 67243442 missense probably benign 0.02
R6352:Myh4 UTSW 11 67252282 missense probably damaging 1.00
R6385:Myh4 UTSW 11 67255837 missense probably damaging 1.00
R6493:Myh4 UTSW 11 67258629 missense probably benign 0.16
R6826:Myh4 UTSW 11 67246531 missense probably damaging 1.00
R6852:Myh4 UTSW 11 67252968 splice site probably null
R6857:Myh4 UTSW 11 67249885 missense possibly damaging 0.74
R7029:Myh4 UTSW 11 67246425 missense probably benign 0.40
R7076:Myh4 UTSW 11 67253173 missense possibly damaging 0.85
R7145:Myh4 UTSW 11 67260228 missense possibly damaging 0.54
R7179:Myh4 UTSW 11 67244724 missense probably benign 0.32
R7365:Myh4 UTSW 11 67242848 missense probably damaging 1.00
R7514:Myh4 UTSW 11 67243322 critical splice donor site probably null
R7553:Myh4 UTSW 11 67256395 missense probably damaging 0.99
R7666:Myh4 UTSW 11 67256281 missense probably damaging 0.99
R7673:Myh4 UTSW 11 67245513 missense probably damaging 1.00
R7685:Myh4 UTSW 11 67240930 missense probably benign 0.13
X0027:Myh4 UTSW 11 67246480 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67248641 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67253505 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67256271 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GATCAACTGGTAGTCATCTGTTCCC -3'
(R):5'- TTAAGGTTTAAGAGTCAGGCTTGAG -3'

Sequencing Primer
(F):5'- GGTAGTCATCTGTTCCCAATTTTG -3'
(R):5'- AGTCAGGCTTGAGTATTTGTAAATGC -3'
Posted On2018-07-23