Incidental Mutation 'R6666:Itga3'
ID526985
Institutional Source Beutler Lab
Gene Symbol Itga3
Ensembl Gene ENSMUSG00000001507
Gene Nameintegrin alpha 3
SynonymsVLA-3 alpha 3, alpha3-integrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location95044474-95076801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95065826 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 170 (T170A)
Ref Sequence ENSEMBL: ENSMUSP00000103368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001548] [ENSMUST00000107739] [ENSMUST00000120375]
Predicted Effect probably benign
Transcript: ENSMUST00000001548
AA Change: T201A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001548
Gene: ENSMUSG00000001507
AA Change: T201A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 7e-54 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107739
AA Change: T170A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103368
Gene: ENSMUSG00000001507
AA Change: T170A

DomainStartEndE-ValueType
Int_alpha 20 79 1.05e2 SMART
Int_alpha 215 269 5.01e0 SMART
Int_alpha 273 330 3.07e-14 SMART
Int_alpha 335 388 4.17e-16 SMART
Int_alpha 396 452 7.57e1 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 775 789 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120375
AA Change: T201A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113556
Gene: ENSMUSG00000001507
AA Change: T201A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 2e-53 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140342
Predicted Effect unknown
Transcript: ENSMUST00000145671
AA Change: T142A
SMART Domains Protein: ENSMUSP00000115970
Gene: ENSMUSG00000001507
AA Change: T142A

DomainStartEndE-ValueType
Blast:Int_alpha 6 52 3e-22 BLAST
SCOP:d1m1xa4 8 182 3e-24 SMART
PDB:4IRZ|A 12 168 2e-8 PDB
Blast:Int_alpha 55 88 2e-6 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a subunit of integrin family of cell surface proteins. The encoded protein undergoes post-translational processing to form a disulfide bond-linked dimer comprised of heavy and light chains. At the cell surface, the encoded protein non-covalently associates with the integrin beta-1 subunit to form a heterodimer that interacts with many extracellular matrix proteins including fibronectin and laminin. Mice lacking the encoded protein die during the first day after birth due to severe abnormalities in kidneys. Mice lacking the encoded protein specifically in the basal layer of epidermis display several skin defects and accelerated wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the kidney and submandibular gland, decreased bronchial branching of the lungs, skin blisters at the dermal-epidermal junction, abnormal layering of the cerebral cortex and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Itga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Itga3 APN 11 95065886 missense probably damaging 1.00
IGL02020:Itga3 APN 11 95057390 missense probably benign 0.02
IGL02413:Itga3 APN 11 95068771 missense probably damaging 1.00
IGL02562:Itga3 APN 11 95068793 missense probably benign 0.02
PIT4508001:Itga3 UTSW 11 95055893 missense probably benign 0.20
R0485:Itga3 UTSW 11 95061970 missense probably benign 0.05
R1548:Itga3 UTSW 11 95046919 critical splice donor site probably null
R1677:Itga3 UTSW 11 95055759 missense probably damaging 0.96
R2062:Itga3 UTSW 11 95054076 missense possibly damaging 0.92
R2088:Itga3 UTSW 11 95052494 missense probably benign 0.10
R2679:Itga3 UTSW 11 95068310 splice site probably benign
R3697:Itga3 UTSW 11 95062725 missense probably benign 0.00
R3839:Itga3 UTSW 11 95057269 critical splice donor site probably null
R4210:Itga3 UTSW 11 95062623 missense probably benign 0.00
R4533:Itga3 UTSW 11 95057293 missense probably benign 0.15
R4849:Itga3 UTSW 11 95076271 missense probably benign
R4863:Itga3 UTSW 11 95061967 missense probably damaging 1.00
R4889:Itga3 UTSW 11 95068301 missense probably benign 0.13
R5218:Itga3 UTSW 11 95062748 missense probably benign 0.01
R6046:Itga3 UTSW 11 95062715 missense probably benign 0.28
R6087:Itga3 UTSW 11 95052443 critical splice donor site probably null
R6210:Itga3 UTSW 11 95068891 intron probably benign
R6341:Itga3 UTSW 11 95055851 splice site probably null
R6998:Itga3 UTSW 11 95051462 missense probably benign 0.00
R7106:Itga3 UTSW 11 95055873 missense probably benign 0.00
R7164:Itga3 UTSW 11 95052479 missense possibly damaging 0.85
R7267:Itga3 UTSW 11 95076362 intron probably benign
R7421:Itga3 UTSW 11 95068855 missense probably benign 0.20
R7514:Itga3 UTSW 11 95065896 nonsense probably null
R7533:Itga3 UTSW 11 95046518 missense probably benign 0.45
R7736:Itga3 UTSW 11 95076203 missense probably damaging 1.00
Z1177:Itga3 UTSW 11 95056774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATACTGCTGTTGGCCTGGG -3'
(R):5'- TCTTGTCTAACGCCATATGTGTG -3'

Sequencing Primer
(F):5'- GGGCCTTGTCTCTTGTGACC -3'
(R):5'- TAGGTCTGTGCCCATCGGTAC -3'
Posted On2018-07-23