Incidental Mutation 'R6666:Lmbrd2'
List |< first << previous [record 23 of 45] next >> last >|
ID526991
Institutional Source Beutler Lab
Gene Symbol Lmbrd2
Ensembl Gene ENSMUSG00000039704
Gene NameLMBR1 domain containing 2
Synonyms9930036E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location9140550-9202483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9151569 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 120 (F120I)
Ref Sequence ENSEMBL: ENSMUSP00000154020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090380] [ENSMUST00000190131] [ENSMUST00000227556]
Predicted Effect probably benign
Transcript: ENSMUST00000090380
AA Change: F120I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000087858
Gene: ENSMUSG00000039704
AA Change: F120I

DomainStartEndE-ValueType
Pfam:LMBR1 8 546 4.2e-192 PFAM
low complexity region 574 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190131
SMART Domains Protein: ENSMUSP00000139997
Gene: ENSMUSG00000054115

DomainStartEndE-ValueType
FBOX 65 105 2.3e-10 SMART
LRR 170 194 5.3e-1 SMART
LRR 195 219 5.3e-2 SMART
LRR 220 245 1.2e-1 SMART
LRR 299 324 1.2e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226149
Predicted Effect probably benign
Transcript: ENSMUST00000227556
AA Change: F120I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Lmbrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Lmbrd2 APN 15 9157295 missense probably damaging 1.00
IGL00864:Lmbrd2 APN 15 9175210 missense probably damaging 1.00
IGL01554:Lmbrd2 APN 15 9165819 missense possibly damaging 0.96
IGL02142:Lmbrd2 APN 15 9186685 missense probably damaging 1.00
IGL02176:Lmbrd2 APN 15 9182574 missense probably damaging 1.00
IGL02293:Lmbrd2 APN 15 9172189 missense probably benign
IGL02692:Lmbrd2 APN 15 9149068 missense possibly damaging 0.94
IGL03101:Lmbrd2 APN 15 9186608 missense probably damaging 1.00
R0102:Lmbrd2 UTSW 15 9183952 missense probably damaging 1.00
R0370:Lmbrd2 UTSW 15 9165852 missense probably damaging 0.97
R0379:Lmbrd2 UTSW 15 9149479 missense probably benign 0.00
R0513:Lmbrd2 UTSW 15 9194729 missense probably damaging 1.00
R1610:Lmbrd2 UTSW 15 9186612 missense probably benign 0.19
R1628:Lmbrd2 UTSW 15 9182506 missense probably damaging 1.00
R1844:Lmbrd2 UTSW 15 9177751 nonsense probably null
R2422:Lmbrd2 UTSW 15 9194765 missense possibly damaging 0.83
R3614:Lmbrd2 UTSW 15 9177711 missense probably damaging 1.00
R3924:Lmbrd2 UTSW 15 9149537 missense probably benign
R4014:Lmbrd2 UTSW 15 9151585 splice site probably benign
R4298:Lmbrd2 UTSW 15 9165795 missense possibly damaging 0.92
R5126:Lmbrd2 UTSW 15 9194701 missense possibly damaging 0.91
R5699:Lmbrd2 UTSW 15 9175182 missense probably benign 0.40
R5841:Lmbrd2 UTSW 15 9182570 missense possibly damaging 0.94
R5974:Lmbrd2 UTSW 15 9172115 missense probably benign 0.25
R5988:Lmbrd2 UTSW 15 9182406 intron probably null
R6179:Lmbrd2 UTSW 15 9149175 missense probably damaging 0.99
R7180:Lmbrd2 UTSW 15 9175196 missense possibly damaging 0.90
R7269:Lmbrd2 UTSW 15 9194684 missense probably damaging 1.00
R7341:Lmbrd2 UTSW 15 9165819 missense possibly damaging 0.96
R8066:Lmbrd2 UTSW 15 9172085 missense probably benign 0.35
R8110:Lmbrd2 UTSW 15 9175192 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTTGTCCTTACATATCCGG -3'
(R):5'- AGGACTGGACTGAAGTTCAAAC -3'

Sequencing Primer
(F):5'- TCCTTACATATCCGGTGTTTGG -3'
(R):5'- CATCAAGGAAGGAAACGTCAC -3'
Posted On2018-07-23