Incidental Mutation 'R6666:Foxh1'
ID526992
Institutional Source Beutler Lab
Gene Symbol Foxh1
Ensembl Gene ENSMUSG00000033837
Gene Nameforkhead box H1
SynonymsFast2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76668225-76669948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76668413 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 367 (F367S)
Ref Sequence ENSEMBL: ENSMUSP00000036591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004294] [ENSMUST00000037551] [ENSMUST00000037824] [ENSMUST00000135388] [ENSMUST00000230451] [ENSMUST00000230964]
Predicted Effect probably benign
Transcript: ENSMUST00000004294
SMART Domains Protein: ENSMUSP00000004294
Gene: ENSMUSG00000004187

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 36 45 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
coiled coil region 195 235 N/A INTRINSIC
coiled coil region 274 345 N/A INTRINSIC
KISc 407 740 3.21e-141 SMART
low complexity region 745 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037551
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037824
AA Change: F367S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036591
Gene: ENSMUSG00000033837
AA Change: F367S

DomainStartEndE-ValueType
FH 62 152 2.71e-34 SMART
low complexity region 183 194 N/A INTRINSIC
low complexity region 331 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230207
Predicted Effect probably benign
Transcript: ENSMUST00000230451
Predicted Effect probably benign
Transcript: ENSMUST00000230964
Meta Mutation Damage Score 0.4503 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FOXH1 encodes a human homolog of Xenopus forkhead activin signal transducer-1. FOXH1 protein binds SMAD2 and activates an activin response element via binding the DNA motif TGT(G/T)(T/G)ATT. [provided by RefSeq, Jul 2008]
PHENOTYPE: Conditional knockout of this gene in the lateral plate mesoderm results in death within a few days after birth. Mutant animals exhibit right isomerism affecting the heart, lungs, and stomach. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Foxh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Foxh1 APN 15 76668920 missense probably damaging 1.00
R0112:Foxh1 UTSW 15 76669010 missense probably benign 0.00
R0126:Foxh1 UTSW 15 76669254 missense probably damaging 1.00
R2266:Foxh1 UTSW 15 76668620 missense probably benign 0.00
R5223:Foxh1 UTSW 15 76668729 unclassified probably null
R5775:Foxh1 UTSW 15 76669849 missense probably benign 0.44
R7528:Foxh1 UTSW 15 76669311 missense probably benign 0.03
R8095:Foxh1 UTSW 15 76669008 nonsense probably null
Z1177:Foxh1 UTSW 15 76669021 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTAGCTCTGGTTCATCAAAATG -3'
(R):5'- AGGATTCCGCAGATTCCAGG -3'

Sequencing Primer
(F):5'- TCATCAAAATGATATTCATGGGTGG -3'
(R):5'- TCCTTGTGGGGACAGCTAC -3'
Posted On2018-07-23