Incidental Mutation 'R6666:Ms4a2'
List |< first << previous [record 25 of 45] next >> last >|
ID527001
Institutional Source Beutler Lab
Gene Symbol Ms4a2
Ensembl Gene ENSMUSG00000024680
Gene Namemembrane-spanning 4-domains, subfamily A, member 2
SynonymsFcrbeta, Fce1b, FcRB, Fcer1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11615523-11623719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11618423 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 168 (S168N)
Ref Sequence ENSEMBL: ENSMUSP00000139841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025583] [ENSMUST00000164792] [ENSMUST00000186978] [ENSMUST00000189641]
Predicted Effect probably benign
Transcript: ENSMUST00000025583
AA Change: S164N

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025583
Gene: ENSMUSG00000024680
AA Change: S164N

DomainStartEndE-ValueType
Pfam:CD20 52 121 4e-20 PFAM
transmembrane domain 134 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164792
AA Change: S201N

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127373
Gene: ENSMUSG00000024680
AA Change: S201N

DomainStartEndE-ValueType
Pfam:CD20 52 195 6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186413
Predicted Effect probably benign
Transcript: ENSMUST00000186978
SMART Domains Protein: ENSMUSP00000140628
Gene: ENSMUSG00000024680

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189641
AA Change: S168N

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139841
Gene: ENSMUSG00000024680
AA Change: S168N

DomainStartEndE-ValueType
Pfam:CD20 52 120 2.1e-20 PFAM
transmembrane domain 140 162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a member of the membrane-spanning 4A family. The encoded protein is the beta subunit of the high affinity IgE receptor and is localized to the membrane. The encoded protein is required for full activation of mast cells, including the release of histamine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null mice display decreased susceptibility to passive cutaneous anaphylaxis and abnormal mast cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Ms4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3925:Ms4a2 UTSW 19 11618948 missense probably benign 0.03
R4887:Ms4a2 UTSW 19 11618429 missense possibly damaging 0.69
R6220:Ms4a2 UTSW 19 11617563 missense probably damaging 0.98
R6804:Ms4a2 UTSW 19 11617535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGATCTCATGCCATTTCAG -3'
(R):5'- AGGTTGGAGTCATCACCTCC -3'

Sequencing Primer
(F):5'- CAAGAGCCAGTTTTTTGAG -3'
(R):5'- GTTGGAGTCATCACCTCCAATCAG -3'
Posted On2018-07-23