Mutagenetix > Incidental Mutation

Incidental Mutation 'R6667:Gpat2'

527007

Institutional Source

Beutler Lab

Gene Symbol

Gpat2

Ensembl Gene

ENSMUSG00000046338

Gene Name

glycerol-3-phosphate acyltransferase 2, mitochondrial

Synonyms

Gpat2, A530057A03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6667 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127425199-127436092 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 127431918 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 294 (G294R)

Ref Sequence

ENSEMBL: ENSMUSP00000049619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028848] [ENSMUST00000062211]

AlphaFold

Q14DK4

Predicted Effect

probably benign
Transcript: ENSMUST00000028848

SMART Domains

Protein: ENSMUSP00000028848
Gene: ENSMUSG00000027371

Domain	Start	End	E-Value	Type
low complexity region	47	53	N/A	INTRINSIC
Pfam:FAA_hydrolase	107	313	3.1e-75	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062211
AA Change: G294R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000049619
Gene: ENSMUSG00000046338
AA Change: G294R

Domain	Start	End	E-Value	Type
PlsC	199	333	1.45e-11	SMART
Blast:PlsC	347	387	7e-13	BLAST
low complexity region	431	468	N/A	INTRINSIC
low complexity region	515	528	N/A	INTRINSIC
low complexity region	593	613	N/A	INTRINSIC
low complexity region	664	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123327

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137366

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146757

Meta Mutation Damage Score

0.3984

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

98% (41/42)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3100002H09Rik	G	T	4: 124,610,642	A39E	probably damaging	Het
Agtr1b	T	A	3: 20,315,749	N231I	possibly damaging	Het
Alpk2	T	C	18: 65,307,740	E661G	probably damaging	Het
Ankrd26	C	T	6: 118,507,788	S1496N	probably benign	Het
Asah2	T	C	19: 31,995,358	N659S	probably benign	Het
Atp12a	T	C	14: 56,384,188	V760A	possibly damaging	Het
Casp2	T	C	6: 42,279,836	C343R	probably damaging	Het
Cblb	T	A	16: 52,152,644	M446K	possibly damaging	Het
Cipc	T	C	12: 86,962,090	V241A	probably benign	Het
Ddit4l	A	G	3: 137,626,121	K83E	probably benign	Het
E430018J23Rik	A	G	7: 127,393,423	M5T	probably benign	Het
Epc2	A	G	2: 49,522,669	T220A	probably damaging	Het
Epha5	T	C	5: 84,071,191	D741G	probably damaging	Het
Flg2	A	T	3: 93,201,761	R365S	possibly damaging	Het
Ggn	A	T	7: 29,172,668	H491L	possibly damaging	Het
Gm21119	T	C	8: 20,621,939	S267P	probably benign	Het
Gm8332	A	T	12: 88,249,705	D132E	unknown	Het
Ighv6-4	A	G	12: 114,406,532	V100A	probably benign	Het
Invs	A	T	4: 48,402,870	Y501F	possibly damaging	Het
Iqcm	G	T	8: 75,753,352	G313W	probably damaging	Het
Jph2	A	G	2: 163,376,286	S157P	probably damaging	Het
Mast4	T	C	13: 102,737,496	E1596G	probably damaging	Het
Mllt6	T	A	11: 97,676,934	L759Q	probably damaging	Het
Nalcn	A	G	14: 123,321,323	L837P	probably damaging	Het
Neb	G	A	2: 52,147,189	T6836I	probably damaging	Het
Nol12	T	A	15: 78,940,080	D133E	probably benign	Het
Olfr1136	A	G	2: 87,693,570	V104A	probably benign	Het
Oxtr	C	A	6: 112,477,099		probably benign	Het
Pcmt1	A	G	10: 7,663,149	L38P	probably damaging	Het
Pik3r2	T	C	8: 70,769,173	Y617C	probably damaging	Het
Prl7a2	T	C	13: 27,661,041	N121D	probably benign	Het
Pvr	G	T	7: 19,905,802	Q380K	probably benign	Het
Rtn2	A	G	7: 19,287,259	E188G	probably benign	Het
Setd4	C	A	16: 93,590,030	R260L	probably benign	Het
Six5	A	G	7: 19,096,569	N374D	probably benign	Het
Slc9b1	T	C	3: 135,371,965	I140T	probably damaging	Het
Supt16	A	G	14: 52,172,063	F797L	probably damaging	Het
Tbata	T	C	10: 61,185,363	L262P	probably damaging	Het
Tti1	A	T	2: 158,008,427	C297*	probably null	Het
Ush1c	C	A	7: 46,225,624	G139C	probably damaging	Het
Vmn1r1	C	T	1: 182,157,777	V108I	probably benign	Het
Vmn2r116	C	T	17: 23,401,092	T600I	probably damaging	Het
Zfp873	A	G	10: 82,060,589	T422A	probably benign	Het
Zfp943	G	A	17: 21,992,908	C325Y	probably damaging	Het

Other mutations in Gpat2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Gpat2	APN	2	127432396	missense	probably benign	0.01
IGL00479:Gpat2	APN	2	127434461	missense	probably damaging	0.99
IGL01393:Gpat2	APN	2	127432651	missense	probably damaging	1.00
IGL01759:Gpat2	APN	2	127430896	missense	possibly damaging	0.94
IGL01764:Gpat2	APN	2	127427536	missense	probably benign	0.18
IGL02631:Gpat2	APN	2	127434232	splice site	probably benign
IGL02657:Gpat2	APN	2	127427331	missense	probably benign	0.04
IGL02813:Gpat2	APN	2	127434455	missense	possibly damaging	0.90
IGL02873:Gpat2	APN	2	127431755	missense	probably benign	0.00
IGL02993:Gpat2	APN	2	127427566	missense	probably damaging	1.00
Hygroscopic	UTSW	2	127431918	missense	possibly damaging	0.90
PIT4494001:Gpat2	UTSW	2	127433880	missense	probably benign	0.00
R0078:Gpat2	UTSW	2	127428249	missense	probably damaging	1.00
R0230:Gpat2	UTSW	2	127435845	missense	possibly damaging	0.95
R1619:Gpat2	UTSW	2	127428717	missense	probably benign	0.00
R1851:Gpat2	UTSW	2	127434819	missense	possibly damaging	0.77
R1939:Gpat2	UTSW	2	127435959	makesense	probably null
R2143:Gpat2	UTSW	2	127433762	missense	probably damaging	1.00
R2165:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R2518:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3410:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3411:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3898:Gpat2	UTSW	2	127435098	missense	probably damaging	1.00
R4080:Gpat2	UTSW	2	127433622	missense	probably damaging	0.99
R4725:Gpat2	UTSW	2	127431982	missense	possibly damaging	0.83
R4841:Gpat2	UTSW	2	127433967	missense	probably benign	0.10
R5354:Gpat2	UTSW	2	127428723	missense	probably damaging	1.00
R5941:Gpat2	UTSW	2	127428275	missense	possibly damaging	0.53
R6362:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6374:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6375:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6377:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6380:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6381:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6382:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6383:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6384:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6393:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6565:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6594:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6595:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6649:Gpat2	UTSW	2	127432435	missense	possibly damaging	0.81
R6665:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6666:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6668:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6669:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R7031:Gpat2	UTSW	2	127435475	missense	probably damaging	0.99
R7096:Gpat2	UTSW	2	127428289	missense	probably benign	0.02
R7307:Gpat2	UTSW	2	127434890	missense	probably damaging	1.00
R7313:Gpat2	UTSW	2	127428295	missense	probably damaging	0.99
R7365:Gpat2	UTSW	2	127426981	splice site	probably null
R8111:Gpat2	UTSW	2	127433857	missense	probably damaging	1.00
R8113:Gpat2	UTSW	2	127431347	missense	possibly damaging	0.52
R8729:Gpat2	UTSW	2	127433819	missense	probably damaging	0.99
R9010:Gpat2	UTSW	2	127435226	missense	probably benign	0.28
R9146:Gpat2	UTSW	2	127431286	missense	possibly damaging	0.58
Z1176:Gpat2	UTSW	2	127430882	missense	probably benign
Z1176:Gpat2	UTSW	2	127433808	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTCAGAGGGCATCCTTGC -3'
(R):5'- AACATTGTGCCACCCAGAACTG -3'

Sequencing Primer
(F):5'- CATCCTTGCAAGGGCTGTG -3'
(R):5'- GGTTGATAATCTACTCGGATCCCAG -3'

Posted On

2018-07-23