Incidental Mutation 'R6667:Tti1'
ID 527008
Institutional Source Beutler Lab
Gene Symbol Tti1
Ensembl Gene ENSMUSG00000027650
Gene Name TELO2 interacting protein 1
Synonyms 2610036D13Rik
MMRRC Submission 044787-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.957) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 157823723-157870353 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 157850347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 297 (C297*)
Ref Sequence ENSEMBL: ENSMUSP00000105148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029179] [ENSMUST00000109522] [ENSMUST00000124338]
AlphaFold Q91V83
Predicted Effect probably null
Transcript: ENSMUST00000029179
AA Change: C297*
SMART Domains Protein: ENSMUSP00000029179
Gene: ENSMUSG00000027650
AA Change: C297*

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
low complexity region 401 411 N/A INTRINSIC
low complexity region 494 504 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
SCOP:d1gw5a_ 855 1044 3e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109522
AA Change: C297*
SMART Domains Protein: ENSMUSP00000105148
Gene: ENSMUSG00000027650
AA Change: C297*

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
low complexity region 401 411 N/A INTRINSIC
low complexity region 494 504 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
SCOP:d1gw5a_ 855 1044 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124338
SMART Domains Protein: ENSMUSP00000116592
Gene: ENSMUSG00000027650

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126541
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,504,435 (GRCm39) A39E probably damaging Het
Agtr1b T A 3: 20,369,913 (GRCm39) N231I possibly damaging Het
Alpk2 T C 18: 65,440,811 (GRCm39) E661G probably damaging Het
Ankrd26 C T 6: 118,484,749 (GRCm39) S1496N probably benign Het
Asah2 T C 19: 31,972,758 (GRCm39) N659S probably benign Het
Atp12a T C 14: 56,621,645 (GRCm39) V760A possibly damaging Het
Casp2 T C 6: 42,256,770 (GRCm39) C343R probably damaging Het
Cblb T A 16: 51,973,007 (GRCm39) M446K possibly damaging Het
Cipc T C 12: 87,008,864 (GRCm39) V241A probably benign Het
Ddit4l A G 3: 137,331,882 (GRCm39) K83E probably benign Het
Eif1ad10 A T 12: 88,216,475 (GRCm39) D132E unknown Het
Epc2 A G 2: 49,412,681 (GRCm39) T220A probably damaging Het
Epha5 T C 5: 84,219,050 (GRCm39) D741G probably damaging Het
Flg2 A T 3: 93,109,068 (GRCm39) R365S possibly damaging Het
Ggn A T 7: 28,872,093 (GRCm39) H491L possibly damaging Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Ighv6-4 A G 12: 114,370,152 (GRCm39) V100A probably benign Het
Invs A T 4: 48,402,870 (GRCm39) Y501F possibly damaging Het
Iqcm G T 8: 76,479,980 (GRCm39) G313W probably damaging Het
Jph2 A G 2: 163,218,206 (GRCm39) S157P probably damaging Het
Mast4 T C 13: 102,874,004 (GRCm39) E1596G probably damaging Het
Mllt6 T A 11: 97,567,760 (GRCm39) L759Q probably damaging Het
Nalcn A G 14: 123,558,735 (GRCm39) L837P probably damaging Het
Neb G A 2: 52,037,201 (GRCm39) T6836I probably damaging Het
Nol12 T A 15: 78,824,280 (GRCm39) D133E probably benign Het
Or5w13 A G 2: 87,523,914 (GRCm39) V104A probably benign Het
Oxtr C A 6: 112,454,060 (GRCm39) probably benign Het
Pcmt1 A G 10: 7,538,913 (GRCm39) L38P probably damaging Het
Pik3r2 T C 8: 71,221,817 (GRCm39) Y617C probably damaging Het
Potefam3b T C 8: 21,161,955 (GRCm39) S267P probably benign Het
Prl7a2 T C 13: 27,845,024 (GRCm39) N121D probably benign Het
Pvr G T 7: 19,639,727 (GRCm39) Q380K probably benign Het
Rtn2 A G 7: 19,021,184 (GRCm39) E188G probably benign Het
Setd4 C A 16: 93,386,918 (GRCm39) R260L probably benign Het
Six5 A G 7: 18,830,494 (GRCm39) N374D probably benign Het
Slc9b1 T C 3: 135,077,726 (GRCm39) I140T probably damaging Het
Supt16 A G 14: 52,409,520 (GRCm39) F797L probably damaging Het
Tbata T C 10: 61,021,142 (GRCm39) L262P probably damaging Het
Ush1c C A 7: 45,875,048 (GRCm39) G139C probably damaging Het
Vmn1r1 C T 1: 181,985,342 (GRCm39) V108I probably benign Het
Vmn2r116 C T 17: 23,620,066 (GRCm39) T600I probably damaging Het
Zfp764l1 A G 7: 126,992,595 (GRCm39) M5T probably benign Het
Zfp873 A G 10: 81,896,423 (GRCm39) T422A probably benign Het
Zfp943 G A 17: 22,211,889 (GRCm39) C325Y probably damaging Het
Other mutations in Tti1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Tti1 APN 2 157,850,885 (GRCm39) missense probably damaging 1.00
IGL00434:Tti1 APN 2 157,850,886 (GRCm39) missense probably damaging 1.00
IGL00820:Tti1 APN 2 157,850,888 (GRCm39) missense probably damaging 1.00
IGL00949:Tti1 APN 2 157,824,319 (GRCm39) missense probably benign 0.00
IGL01080:Tti1 APN 2 157,824,379 (GRCm39) missense probably damaging 1.00
IGL01084:Tti1 APN 2 157,824,379 (GRCm39) missense probably damaging 1.00
IGL01339:Tti1 APN 2 157,851,050 (GRCm39) missense possibly damaging 0.80
IGL01685:Tti1 APN 2 157,842,705 (GRCm39) missense probably benign 0.01
IGL01866:Tti1 APN 2 157,849,618 (GRCm39) missense probably benign 0.27
IGL01903:Tti1 APN 2 157,842,542 (GRCm39) missense probably benign 0.01
IGL03142:Tti1 APN 2 157,842,597 (GRCm39) missense probably damaging 0.99
IGL03173:Tti1 APN 2 157,848,932 (GRCm39) unclassified probably benign
IGL03385:Tti1 APN 2 157,834,945 (GRCm39) missense possibly damaging 0.86
R0413:Tti1 UTSW 2 157,837,396 (GRCm39) missense probably benign 0.00
R0601:Tti1 UTSW 2 157,835,292 (GRCm39) missense probably damaging 0.99
R1718:Tti1 UTSW 2 157,850,144 (GRCm39) missense probably benign 0.40
R1760:Tti1 UTSW 2 157,834,955 (GRCm39) missense possibly damaging 0.87
R1761:Tti1 UTSW 2 157,849,617 (GRCm39) missense probably benign 0.01
R1968:Tti1 UTSW 2 157,850,966 (GRCm39) missense possibly damaging 0.66
R2054:Tti1 UTSW 2 157,849,365 (GRCm39) missense possibly damaging 0.79
R2131:Tti1 UTSW 2 157,842,663 (GRCm39) missense probably benign
R3886:Tti1 UTSW 2 157,850,870 (GRCm39) missense possibly damaging 0.74
R4479:Tti1 UTSW 2 157,850,315 (GRCm39) missense possibly damaging 0.95
R4647:Tti1 UTSW 2 157,848,940 (GRCm39) unclassified probably benign
R5124:Tti1 UTSW 2 157,850,115 (GRCm39) missense probably damaging 0.99
R5145:Tti1 UTSW 2 157,850,432 (GRCm39) missense probably benign 0.30
R5852:Tti1 UTSW 2 157,842,593 (GRCm39) missense probably damaging 1.00
R6714:Tti1 UTSW 2 157,848,971 (GRCm39) missense possibly damaging 0.73
R6719:Tti1 UTSW 2 157,824,220 (GRCm39) missense probably benign 0.01
R7143:Tti1 UTSW 2 157,849,596 (GRCm39) missense probably benign
R7490:Tti1 UTSW 2 157,837,392 (GRCm39) missense probably damaging 1.00
R7540:Tti1 UTSW 2 157,849,916 (GRCm39) missense probably benign 0.43
R7549:Tti1 UTSW 2 157,849,088 (GRCm39) missense probably damaging 1.00
R7641:Tti1 UTSW 2 157,850,949 (GRCm39) missense possibly damaging 0.92
R7654:Tti1 UTSW 2 157,850,474 (GRCm39) missense probably benign 0.00
R7716:Tti1 UTSW 2 157,842,618 (GRCm39) missense probably benign 0.43
R7722:Tti1 UTSW 2 157,849,527 (GRCm39) missense probably benign 0.00
R7898:Tti1 UTSW 2 157,835,390 (GRCm39) missense probably benign 0.00
R8117:Tti1 UTSW 2 157,849,418 (GRCm39) missense probably damaging 1.00
R8145:Tti1 UTSW 2 157,849,509 (GRCm39) nonsense probably null
R8249:Tti1 UTSW 2 157,842,635 (GRCm39) missense probably benign
R8712:Tti1 UTSW 2 157,834,930 (GRCm39) missense probably damaging 1.00
R8784:Tti1 UTSW 2 157,850,514 (GRCm39) missense probably benign 0.02
R8912:Tti1 UTSW 2 157,851,188 (GRCm39) missense probably benign 0.00
R9352:Tti1 UTSW 2 157,842,692 (GRCm39) missense probably benign 0.00
R9725:Tti1 UTSW 2 157,849,304 (GRCm39) missense probably benign 0.13
Z1176:Tti1 UTSW 2 157,824,349 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACGCCTCAGCACTGTAC -3'
(R):5'- TAAACAAGGTCACAGCATTGTCG -3'

Sequencing Primer
(F):5'- TCAGCACTGTACTGCACCG -3'
(R):5'- ACAGCATTGTCGTGTCTTCTCTAAAG -3'
Posted On 2018-07-23