Incidental Mutation 'R6667:Agtr1b'
ID527009
Institutional Source Beutler Lab
Gene Symbol Agtr1b
Ensembl Gene ENSMUSG00000054988
Gene Nameangiotensin II receptor, type 1b
SynonymsAgtr-1b, Angtr-1b, AT1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6667 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location20314473-20367177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20315749 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 231 (N231I)
Ref Sequence ENSEMBL: ENSMUSP00000128724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068316] [ENSMUST00000163776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068316
AA Change: N231I

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068298
Gene: ENSMUSG00000054988
AA Change: N231I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 310 5.4e-10 PFAM
Pfam:7tm_1 45 302 3e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163776
AA Change: N231I

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128724
Gene: ENSMUSG00000054988
AA Change: N231I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 310 5.4e-10 PFAM
Pfam:7tm_1 45 302 1.1e-65 PFAM
Meta Mutation Damage Score 0.1468 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations are phenotypically normal, but homozygotes for the Agtr1b/Agtr1a double knockout exhibit reductions in growth, survival, blood pressure, and kidney size not found in either single knockout. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Agtr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01558:Agtr1b APN 3 20316260 missense probably damaging 0.99
IGL02706:Agtr1b APN 3 20315863 missense probably benign 0.01
IGL02958:Agtr1b APN 3 20316094 missense possibly damaging 0.91
IGL03243:Agtr1b APN 3 20315795 missense probably benign 0.13
R0125:Agtr1b UTSW 3 20315540 missense probably benign 0.00
R0565:Agtr1b UTSW 3 20315674 missense probably damaging 0.99
R0661:Agtr1b UTSW 3 20315999 missense possibly damaging 0.83
R1070:Agtr1b UTSW 3 20315748 missense probably benign 0.34
R1469:Agtr1b UTSW 3 20315500 missense probably damaging 1.00
R1469:Agtr1b UTSW 3 20315500 missense probably damaging 1.00
R1713:Agtr1b UTSW 3 20316309 missense probably benign 0.00
R4502:Agtr1b UTSW 3 20315798 missense probably damaging 1.00
R5613:Agtr1b UTSW 3 20316260 missense probably damaging 0.99
R6142:Agtr1b UTSW 3 20316394 missense probably benign 0.06
R6320:Agtr1b UTSW 3 20315779 missense probably benign 0.22
R6987:Agtr1b UTSW 3 20316421 missense probably benign 0.00
R7407:Agtr1b UTSW 3 20315731 missense possibly damaging 0.79
R7598:Agtr1b UTSW 3 20315913 missense possibly damaging 0.91
X0037:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0060:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0063:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0063:Agtr1b UTSW 3 20315506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGGGCATAGCAGTGTC -3'
(R):5'- CCTGCATCATCATCTGGCTG -3'

Sequencing Primer
(F):5'- GCATAGCAGTGTCCACTACGTC -3'
(R):5'- GCCGTCATCCACCGAAATGTG -3'
Posted On2018-07-23