Incidental Mutation 'R6667:Invs'
ID 527013
Institutional Source Beutler Lab
Gene Symbol Invs
Ensembl Gene ENSMUSG00000028344
Gene Name inversin
Synonyms
MMRRC Submission 044787-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.658) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 48279760-48431954 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48402870 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 501 (Y501F)
Ref Sequence ENSEMBL: ENSMUSP00000030029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000030029
AA Change: Y501F

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: Y501F

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143433
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,504,435 (GRCm39) A39E probably damaging Het
Agtr1b T A 3: 20,369,913 (GRCm39) N231I possibly damaging Het
Alpk2 T C 18: 65,440,811 (GRCm39) E661G probably damaging Het
Ankrd26 C T 6: 118,484,749 (GRCm39) S1496N probably benign Het
Asah2 T C 19: 31,972,758 (GRCm39) N659S probably benign Het
Atp12a T C 14: 56,621,645 (GRCm39) V760A possibly damaging Het
Casp2 T C 6: 42,256,770 (GRCm39) C343R probably damaging Het
Cblb T A 16: 51,973,007 (GRCm39) M446K possibly damaging Het
Cipc T C 12: 87,008,864 (GRCm39) V241A probably benign Het
Ddit4l A G 3: 137,331,882 (GRCm39) K83E probably benign Het
Eif1ad10 A T 12: 88,216,475 (GRCm39) D132E unknown Het
Epc2 A G 2: 49,412,681 (GRCm39) T220A probably damaging Het
Epha5 T C 5: 84,219,050 (GRCm39) D741G probably damaging Het
Flg2 A T 3: 93,109,068 (GRCm39) R365S possibly damaging Het
Ggn A T 7: 28,872,093 (GRCm39) H491L possibly damaging Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Ighv6-4 A G 12: 114,370,152 (GRCm39) V100A probably benign Het
Iqcm G T 8: 76,479,980 (GRCm39) G313W probably damaging Het
Jph2 A G 2: 163,218,206 (GRCm39) S157P probably damaging Het
Mast4 T C 13: 102,874,004 (GRCm39) E1596G probably damaging Het
Mllt6 T A 11: 97,567,760 (GRCm39) L759Q probably damaging Het
Nalcn A G 14: 123,558,735 (GRCm39) L837P probably damaging Het
Neb G A 2: 52,037,201 (GRCm39) T6836I probably damaging Het
Nol12 T A 15: 78,824,280 (GRCm39) D133E probably benign Het
Or5w13 A G 2: 87,523,914 (GRCm39) V104A probably benign Het
Oxtr C A 6: 112,454,060 (GRCm39) probably benign Het
Pcmt1 A G 10: 7,538,913 (GRCm39) L38P probably damaging Het
Pik3r2 T C 8: 71,221,817 (GRCm39) Y617C probably damaging Het
Potefam3b T C 8: 21,161,955 (GRCm39) S267P probably benign Het
Prl7a2 T C 13: 27,845,024 (GRCm39) N121D probably benign Het
Pvr G T 7: 19,639,727 (GRCm39) Q380K probably benign Het
Rtn2 A G 7: 19,021,184 (GRCm39) E188G probably benign Het
Setd4 C A 16: 93,386,918 (GRCm39) R260L probably benign Het
Six5 A G 7: 18,830,494 (GRCm39) N374D probably benign Het
Slc9b1 T C 3: 135,077,726 (GRCm39) I140T probably damaging Het
Supt16 A G 14: 52,409,520 (GRCm39) F797L probably damaging Het
Tbata T C 10: 61,021,142 (GRCm39) L262P probably damaging Het
Tti1 A T 2: 157,850,347 (GRCm39) C297* probably null Het
Ush1c C A 7: 45,875,048 (GRCm39) G139C probably damaging Het
Vmn1r1 C T 1: 181,985,342 (GRCm39) V108I probably benign Het
Vmn2r116 C T 17: 23,620,066 (GRCm39) T600I probably damaging Het
Zfp764l1 A G 7: 126,992,595 (GRCm39) M5T probably benign Het
Zfp873 A G 10: 81,896,423 (GRCm39) T422A probably benign Het
Zfp943 G A 17: 22,211,889 (GRCm39) C325Y probably damaging Het
Other mutations in Invs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Invs APN 4 48,402,909 (GRCm39) missense probably damaging 0.98
IGL00487:Invs APN 4 48,407,689 (GRCm39) nonsense probably null
IGL01487:Invs APN 4 48,398,136 (GRCm39) missense probably benign 0.26
IGL01696:Invs APN 4 48,425,997 (GRCm39) missense probably damaging 1.00
IGL02238:Invs APN 4 48,390,029 (GRCm39) missense probably damaging 1.00
IGL03286:Invs APN 4 48,382,261 (GRCm39) missense probably benign 0.26
R0645:Invs UTSW 4 48,407,653 (GRCm39) missense probably benign 0.00
R0661:Invs UTSW 4 48,421,861 (GRCm39) missense probably benign
R0698:Invs UTSW 4 48,396,364 (GRCm39) missense probably benign 0.04
R0763:Invs UTSW 4 48,392,628 (GRCm39) missense possibly damaging 0.82
R1183:Invs UTSW 4 48,421,725 (GRCm39) missense possibly damaging 0.68
R1381:Invs UTSW 4 48,421,942 (GRCm39) nonsense probably null
R1511:Invs UTSW 4 48,382,148 (GRCm39) missense possibly damaging 0.82
R1843:Invs UTSW 4 48,422,035 (GRCm39) missense probably damaging 0.96
R1903:Invs UTSW 4 48,402,824 (GRCm39) splice site probably null
R1928:Invs UTSW 4 48,390,095 (GRCm39) missense probably damaging 1.00
R1990:Invs UTSW 4 48,392,599 (GRCm39) missense possibly damaging 0.88
R2063:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2064:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2065:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2066:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R4744:Invs UTSW 4 48,397,609 (GRCm39) missense probably damaging 1.00
R4997:Invs UTSW 4 48,396,332 (GRCm39) missense probably damaging 0.98
R5011:Invs UTSW 4 48,421,807 (GRCm39) missense probably damaging 1.00
R5013:Invs UTSW 4 48,421,807 (GRCm39) missense probably damaging 1.00
R5083:Invs UTSW 4 48,396,307 (GRCm39) missense possibly damaging 0.90
R5184:Invs UTSW 4 48,283,242 (GRCm39) utr 5 prime probably benign
R5258:Invs UTSW 4 48,396,374 (GRCm39) missense possibly damaging 0.82
R5375:Invs UTSW 4 48,385,262 (GRCm39) missense probably benign 0.12
R5509:Invs UTSW 4 48,396,337 (GRCm39) missense probably damaging 1.00
R5560:Invs UTSW 4 48,416,084 (GRCm39) missense probably benign 0.00
R5748:Invs UTSW 4 48,307,823 (GRCm39) missense probably damaging 0.98
R5813:Invs UTSW 4 48,398,146 (GRCm39) missense probably damaging 0.98
R5840:Invs UTSW 4 48,396,284 (GRCm39) missense probably damaging 1.00
R5984:Invs UTSW 4 48,421,674 (GRCm39) missense probably benign 0.00
R6513:Invs UTSW 4 48,397,534 (GRCm39) missense possibly damaging 0.46
R6637:Invs UTSW 4 48,416,203 (GRCm39) splice site probably null
R6838:Invs UTSW 4 48,283,278 (GRCm39) missense possibly damaging 0.95
R6921:Invs UTSW 4 48,396,260 (GRCm39) missense possibly damaging 0.46
R6945:Invs UTSW 4 48,421,785 (GRCm39) missense probably benign 0.00
R7102:Invs UTSW 4 48,407,674 (GRCm39) missense probably benign 0.21
R7142:Invs UTSW 4 48,407,696 (GRCm39) missense probably damaging 1.00
R7263:Invs UTSW 4 48,396,381 (GRCm39) missense probably damaging 1.00
R7283:Invs UTSW 4 48,392,526 (GRCm39) splice site probably null
R7461:Invs UTSW 4 48,392,668 (GRCm39) missense probably damaging 1.00
R7503:Invs UTSW 4 48,396,347 (GRCm39) missense probably damaging 0.96
R7581:Invs UTSW 4 48,421,909 (GRCm39) missense probably benign 0.00
R7613:Invs UTSW 4 48,392,668 (GRCm39) missense probably damaging 1.00
R7861:Invs UTSW 4 48,397,559 (GRCm39) missense possibly damaging 0.50
R8316:Invs UTSW 4 48,426,199 (GRCm39) missense possibly damaging 0.68
R8321:Invs UTSW 4 48,283,267 (GRCm39) missense probably benign 0.13
R8500:Invs UTSW 4 48,422,109 (GRCm39) missense probably damaging 1.00
R8544:Invs UTSW 4 48,397,598 (GRCm39) missense probably damaging 0.96
R9171:Invs UTSW 4 48,398,149 (GRCm39) missense possibly damaging 0.90
R9663:Invs UTSW 4 48,426,218 (GRCm39) missense probably damaging 1.00
X0026:Invs UTSW 4 48,398,221 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCATGCTAATTGTGATTACTCTGG -3'
(R):5'- TGCTTGCTACAGTATTTGCCTATG -3'

Sequencing Primer
(F):5'- AAGAACCATCTGTTTTCTCCATTG -3'
(R):5'- CAGTATTTGCCTATGAGTATACTTGC -3'
Posted On 2018-07-23