Incidental Mutation 'R6667:Invs'
ID 527013
Institutional Source Beutler Lab
Gene Symbol Invs
Ensembl Gene ENSMUSG00000028344
Gene Name inversin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.609) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 48279760-48431954 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48402870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 501 (Y501F)
Ref Sequence ENSEMBL: ENSMUSP00000030029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000030029
AA Change: Y501F

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: Y501F

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143433
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Invs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Invs APN 4 48402909 missense probably damaging 0.98
IGL00487:Invs APN 4 48407689 nonsense probably null
IGL01487:Invs APN 4 48398136 missense probably benign 0.26
IGL01696:Invs APN 4 48425997 missense probably damaging 1.00
IGL02238:Invs APN 4 48390029 missense probably damaging 1.00
IGL03286:Invs APN 4 48382261 missense probably benign 0.26
R0645:Invs UTSW 4 48407653 missense probably benign 0.00
R0661:Invs UTSW 4 48421861 missense probably benign
R0698:Invs UTSW 4 48396364 missense probably benign 0.04
R0763:Invs UTSW 4 48392628 missense possibly damaging 0.82
R1183:Invs UTSW 4 48421725 missense possibly damaging 0.68
R1381:Invs UTSW 4 48421942 nonsense probably null
R1511:Invs UTSW 4 48382148 missense possibly damaging 0.82
R1843:Invs UTSW 4 48422035 missense probably damaging 0.96
R1903:Invs UTSW 4 48402824 splice site probably null
R1928:Invs UTSW 4 48390095 missense probably damaging 1.00
R1990:Invs UTSW 4 48392599 missense possibly damaging 0.88
R2063:Invs UTSW 4 48396287 missense probably damaging 1.00
R2064:Invs UTSW 4 48396287 missense probably damaging 1.00
R2065:Invs UTSW 4 48396287 missense probably damaging 1.00
R2066:Invs UTSW 4 48396287 missense probably damaging 1.00
R4744:Invs UTSW 4 48397609 missense probably damaging 1.00
R4997:Invs UTSW 4 48396332 missense probably damaging 0.98
R5011:Invs UTSW 4 48421807 missense probably damaging 1.00
R5013:Invs UTSW 4 48421807 missense probably damaging 1.00
R5083:Invs UTSW 4 48396307 missense possibly damaging 0.90
R5184:Invs UTSW 4 48283242 utr 5 prime probably benign
R5258:Invs UTSW 4 48396374 missense possibly damaging 0.82
R5375:Invs UTSW 4 48385262 missense probably benign 0.12
R5509:Invs UTSW 4 48396337 missense probably damaging 1.00
R5560:Invs UTSW 4 48416084 missense probably benign 0.00
R5748:Invs UTSW 4 48307823 missense probably damaging 0.98
R5813:Invs UTSW 4 48398146 missense probably damaging 0.98
R5840:Invs UTSW 4 48396284 missense probably damaging 1.00
R5984:Invs UTSW 4 48421674 missense probably benign 0.00
R6513:Invs UTSW 4 48397534 missense possibly damaging 0.46
R6637:Invs UTSW 4 48416203 splice site probably null
R6838:Invs UTSW 4 48283278 missense possibly damaging 0.95
R6921:Invs UTSW 4 48396260 missense possibly damaging 0.46
R6945:Invs UTSW 4 48421785 missense probably benign 0.00
R7102:Invs UTSW 4 48407674 missense probably benign 0.21
R7142:Invs UTSW 4 48407696 missense probably damaging 1.00
R7263:Invs UTSW 4 48396381 missense probably damaging 1.00
R7283:Invs UTSW 4 48392526 splice site probably null
R7461:Invs UTSW 4 48392668 missense probably damaging 1.00
R7503:Invs UTSW 4 48396347 missense probably damaging 0.96
R7581:Invs UTSW 4 48421909 missense probably benign 0.00
R7613:Invs UTSW 4 48392668 missense probably damaging 1.00
R7861:Invs UTSW 4 48397559 missense possibly damaging 0.50
R8316:Invs UTSW 4 48426199 missense possibly damaging 0.68
R8321:Invs UTSW 4 48283267 missense probably benign 0.13
R8500:Invs UTSW 4 48422109 missense probably damaging 1.00
R8544:Invs UTSW 4 48397598 missense probably damaging 0.96
R9171:Invs UTSW 4 48398149 missense possibly damaging 0.90
R9663:Invs UTSW 4 48426218 missense probably damaging 1.00
X0026:Invs UTSW 4 48398221 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCATGCTAATTGTGATTACTCTGG -3'
(R):5'- TGCTTGCTACAGTATTTGCCTATG -3'

Sequencing Primer
(F):5'- AAGAACCATCTGTTTTCTCCATTG -3'
(R):5'- CAGTATTTGCCTATGAGTATACTTGC -3'
Posted On 2018-07-23