Incidental Mutation 'R6667:Casp2'
ID 527016
Institutional Source Beutler Lab
Gene Symbol Casp2
Ensembl Gene ENSMUSG00000029863
Gene Name caspase 2
Synonyms Nedd2, Caspase-2, Ich-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42264985-42282508 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42279836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 343 (C343R)
Ref Sequence ENSEMBL: ENSMUSP00000031895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031895] [ENSMUST00000156829]
AlphaFold P29594
Predicted Effect probably damaging
Transcript: ENSMUST00000031895
AA Change: C343R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031895
Gene: ENSMUSG00000029863
AA Change: C343R

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 447 3.27e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152893
Predicted Effect probably benign
Transcript: ENSMUST00000156829
SMART Domains Protein: ENSMUSP00000121184
Gene: ENSMUSG00000029863

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 341 8.07e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203089
Meta Mutation Damage Score 0.3848 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes the evolutionarily ancient and most conserved member of the cysteine proteases that plays important role in stress-induced apoptosis, DNA repair and tumor suppression. Mice lacking the encoded protein develop normally but display cell type-specific apoptotic defects. Germ cells and oocytes from such mice were found to be resistant to cell death after treatment with chemotherapeutic drugs. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal apoptosis. Apoptosis is reduced in the female germline, but is increased in sympathetic neurons during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Casp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Casp2 APN 6 42269285 nonsense probably null
IGL02094:Casp2 APN 6 42280359 missense probably damaging 1.00
IGL02371:Casp2 APN 6 42267968 missense probably benign 0.00
IGL02414:Casp2 APN 6 42280446 missense probably damaging 1.00
IGL03298:Casp2 APN 6 42268990 splice site probably benign
R1240:Casp2 UTSW 6 42268945 missense probably damaging 1.00
R1424:Casp2 UTSW 6 42276791 splice site probably benign
R1672:Casp2 UTSW 6 42268908 missense probably damaging 1.00
R4110:Casp2 UTSW 6 42267894 missense probably damaging 1.00
R4113:Casp2 UTSW 6 42267894 missense probably damaging 1.00
R5062:Casp2 UTSW 6 42269272 splice site probably benign
R5469:Casp2 UTSW 6 42269334 missense probably benign 0.00
R5835:Casp2 UTSW 6 42267586 missense possibly damaging 0.84
R5877:Casp2 UTSW 6 42276637 intron probably benign
R6103:Casp2 UTSW 6 42279880 missense probably damaging 0.99
R6702:Casp2 UTSW 6 42268051 missense probably benign
R6754:Casp2 UTSW 6 42269330 missense probably damaging 1.00
R7141:Casp2 UTSW 6 42280395 missense possibly damaging 0.68
R7255:Casp2 UTSW 6 42268907 missense probably damaging 1.00
R7611:Casp2 UTSW 6 42274038 missense possibly damaging 0.95
R9135:Casp2 UTSW 6 42268948 missense probably benign 0.03
R9350:Casp2 UTSW 6 42269398 missense probably benign 0.15
X0065:Casp2 UTSW 6 42280143 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCTACAGGTTGGAGGCAAC -3'
(R):5'- GGCAAGCTTCACAAAGTCAG -3'

Sequencing Primer
(F):5'- CAGCTAAAAATGGCTCTTCAGTCG -3'
(R):5'- GCTTCACAAAGTCAGACTTCTAGTC -3'
Posted On 2018-07-23