Incidental Mutation 'R6667:Oxtr'
ID527017
Institutional Source Beutler Lab
Gene Symbol Oxtr
Ensembl Gene ENSMUSG00000049112
Gene Nameoxytocin receptor
SynonymsOTR
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6667 (G1)
Quality Score141.008
Status Validated
Chromosome6
Chromosomal Location112473683-112489943 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 112477099 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053306] [ENSMUST00000075477] [ENSMUST00000204027]
Predicted Effect unknown
Transcript: ENSMUST00000053306
AA Change: S381I
SMART Domains Protein: ENSMUSP00000051132
Gene: ENSMUSG00000049112
AA Change: S381I

DomainStartEndE-ValueType
Pfam:7tm_4 46 183 2.5e-8 PFAM
Pfam:7TM_GPCR_Srsx 50 339 1.4e-6 PFAM
Pfam:7tm_1 56 328 3.4e-46 PFAM
low complexity region 365 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075477
SMART Domains Protein: ENSMUSP00000074922
Gene: ENSMUSG00000062694

DomainStartEndE-ValueType
Pfam:Caveolin 15 148 9.5e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000204027
AA Change: S68I
SMART Domains Protein: ENSMUSP00000145300
Gene: ENSMUSG00000049112
AA Change: S68I

DomainStartEndE-ValueType
SCOP:d1l9ha_ 2 56 2e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein coupled receptor family and acts as a receptor for oxytocin. Its activity is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. The oxytocin-oxytocin receptor system plays an important role in the uterus during parturition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females fail to lactate and exhibit decreased maternal behavior. Males exhibit an increase in aggression, hypoactivity and vocalization in response to social isolation, and social amnesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Oxtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02418:Oxtr APN 6 112477239 missense probably damaging 1.00
R0610:Oxtr UTSW 6 112477177 missense probably benign 0.08
R0635:Oxtr UTSW 6 112489200 missense probably damaging 1.00
R0924:Oxtr UTSW 6 112489637 unclassified probably null
R0930:Oxtr UTSW 6 112489637 unclassified probably null
R0959:Oxtr UTSW 6 112477177 missense probably benign 0.08
R0961:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1099:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1101:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1102:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1344:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1401:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1682:Oxtr UTSW 6 112477177 missense probably benign 0.08
R2254:Oxtr UTSW 6 112489106 missense probably damaging 0.98
R3424:Oxtr UTSW 6 112477230 missense probably benign 0.31
R3805:Oxtr UTSW 6 112477186 missense probably benign 0.14
R4598:Oxtr UTSW 6 112489752 missense probably benign 0.20
R5757:Oxtr UTSW 6 112477261 missense probably damaging 1.00
R5821:Oxtr UTSW 6 112489496 missense probably damaging 1.00
Z1176:Oxtr UTSW 6 112489695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGACCCTGTCATCTCCCATG -3'
(R):5'- AACAGCTGCTGCAACCCATG -3'

Sequencing Primer
(F):5'- TTTCCCTACCCCAAGTCAGAATATG -3'
(R):5'- ATGGATCTACATGCTCTTCACGGG -3'
Posted On2018-07-23