Mutagenetix > Incidental Mutation

Incidental Mutation 'R6667:Ankrd26'

527018

Institutional Source

Beutler Lab

Gene Symbol

Ankrd26

Ensembl Gene

ENSMUSG00000007827

Gene Name

ankyrin repeat domain 26

Synonyms

5730521P14Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081112;MGI: 1917887

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6667 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118501308-118562226 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 118507788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 1496 (S1496N)

Ref Sequence

ENSEMBL: ENSMUSP00000108449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112830]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000112830
AA Change: S1496N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000108449
Gene: ENSMUSG00000007827
AA Change: S1496N

Domain	Start	End	E-Value	Type
ANK	80	109	1.5e-7	SMART
ANK	113	142	3.5e-4	SMART
ANK	146	175	1.9e-6	SMART
ANK	179	208	2.2e-4	SMART
low complexity region	306	316	N/A	INTRINSIC
low complexity region	568	580	N/A	INTRINSIC
Blast:BRLZ	692	754	4e-10	BLAST
Pfam:CCDC144C	886	1190	2e-142	PFAM
low complexity region	1298	1315	N/A	INTRINSIC
low complexity region	1345	1357	N/A	INTRINSIC
coiled coil region	1407	1444	N/A	INTRINSIC
low complexity region	1473	1486	N/A	INTRINSIC
Pfam:DUF3496	1495	1602	1.3e-47	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing N-terminal ankyrin repeats which function in protein-protein interactions. Mutations in this gene are associated with autosomal dominant thrombocytopenia-2. Pseudogenes of this gene are found on chromosome 7, 10, 13 and 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele have enlarged kidneys and hearts, exhibit increased lean body mass and adiposity, develop extreme obesity associated with hyperphagia rather than reduced energy expenditure, and show insulin resistance and gigantism. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3100002H09Rik	G	T	4: 124,610,642	A39E	probably damaging	Het
Agtr1b	T	A	3: 20,315,749	N231I	possibly damaging	Het
Alpk2	T	C	18: 65,307,740	E661G	probably damaging	Het
Asah2	T	C	19: 31,995,358	N659S	probably benign	Het
Atp12a	T	C	14: 56,384,188	V760A	possibly damaging	Het
Casp2	T	C	6: 42,279,836	C343R	probably damaging	Het
Cblb	T	A	16: 52,152,644	M446K	possibly damaging	Het
Cipc	T	C	12: 86,962,090	V241A	probably benign	Het
Ddit4l	A	G	3: 137,626,121	K83E	probably benign	Het
E430018J23Rik	A	G	7: 127,393,423	M5T	probably benign	Het
Epc2	A	G	2: 49,522,669	T220A	probably damaging	Het
Epha5	T	C	5: 84,071,191	D741G	probably damaging	Het
Flg2	A	T	3: 93,201,761	R365S	possibly damaging	Het
Ggn	A	T	7: 29,172,668	H491L	possibly damaging	Het
Gm21119	T	C	8: 20,621,939	S267P	probably benign	Het
Gm8332	A	T	12: 88,249,705	D132E	unknown	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Ighv6-4	A	G	12: 114,406,532	V100A	probably benign	Het
Invs	A	T	4: 48,402,870	Y501F	possibly damaging	Het
Iqcm	G	T	8: 75,753,352	G313W	probably damaging	Het
Jph2	A	G	2: 163,376,286	S157P	probably damaging	Het
Mast4	T	C	13: 102,737,496	E1596G	probably damaging	Het
Mllt6	T	A	11: 97,676,934	L759Q	probably damaging	Het
Nalcn	A	G	14: 123,321,323	L837P	probably damaging	Het
Neb	G	A	2: 52,147,189	T6836I	probably damaging	Het
Nol12	T	A	15: 78,940,080	D133E	probably benign	Het
Olfr1136	A	G	2: 87,693,570	V104A	probably benign	Het
Oxtr	C	A	6: 112,477,099		probably benign	Het
Pcmt1	A	G	10: 7,663,149	L38P	probably damaging	Het
Pik3r2	T	C	8: 70,769,173	Y617C	probably damaging	Het
Prl7a2	T	C	13: 27,661,041	N121D	probably benign	Het
Pvr	G	T	7: 19,905,802	Q380K	probably benign	Het
Rtn2	A	G	7: 19,287,259	E188G	probably benign	Het
Setd4	C	A	16: 93,590,030	R260L	probably benign	Het
Six5	A	G	7: 19,096,569	N374D	probably benign	Het
Slc9b1	T	C	3: 135,371,965	I140T	probably damaging	Het
Supt16	A	G	14: 52,172,063	F797L	probably damaging	Het
Tbata	T	C	10: 61,185,363	L262P	probably damaging	Het
Tti1	A	T	2: 158,008,427	C297*	probably null	Het
Ush1c	C	A	7: 46,225,624	G139C	probably damaging	Het
Vmn1r1	C	T	1: 182,157,777	V108I	probably benign	Het
Vmn2r116	C	T	17: 23,401,092	T600I	probably damaging	Het
Zfp873	A	G	10: 82,060,589	T422A	probably benign	Het
Zfp943	G	A	17: 21,992,908	C325Y	probably damaging	Het

Other mutations in Ankrd26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Ankrd26	APN	6	118559358	nonsense	probably null
IGL01286:Ankrd26	APN	6	118559107	missense	probably damaging	1.00
IGL01574:Ankrd26	APN	6	118539698	missense	probably damaging	1.00
IGL01727:Ankrd26	APN	6	118511636	missense	probably damaging	1.00
IGL01954:Ankrd26	APN	6	118559005	missense	possibly damaging	0.62
IGL02200:Ankrd26	APN	6	118559341	missense	probably damaging	1.00
IGL02708:Ankrd26	APN	6	118518418	splice site	probably benign
IGL02973:Ankrd26	APN	6	118523550	missense	probably damaging	0.98
IGL03233:Ankrd26	APN	6	118535146	splice site	probably null
guillemot	UTSW	6	118507637	critical splice donor site	probably null
Iceland	UTSW	6	118549428	missense	probably benign	0.30
murre	UTSW	6	118549637	critical splice donor site	probably null
ANU74:Ankrd26	UTSW	6	118552775	missense	probably benign	0.02
N/A:Ankrd26	UTSW	6	118529574	missense	probably benign	0.04
R0078:Ankrd26	UTSW	6	118535069	splice site	probably benign
R0083:Ankrd26	UTSW	6	118523254	missense	probably benign	0.36
R0165:Ankrd26	UTSW	6	118540484	missense	probably benign	0.01
R0344:Ankrd26	UTSW	6	118507637	critical splice donor site	probably null
R0828:Ankrd26	UTSW	6	118533473	splice site	probably benign
R1532:Ankrd26	UTSW	6	118522958	missense	probably damaging	1.00
R1809:Ankrd26	UTSW	6	118525922	splice site	probably benign
R1875:Ankrd26	UTSW	6	118540449	critical splice donor site	probably null
R1940:Ankrd26	UTSW	6	118511693	missense	probably damaging	1.00
R2164:Ankrd26	UTSW	6	118525791	missense	probably damaging	1.00
R2202:Ankrd26	UTSW	6	118523882	missense	possibly damaging	0.79
R2204:Ankrd26	UTSW	6	118523882	missense	possibly damaging	0.79
R2205:Ankrd26	UTSW	6	118523882	missense	possibly damaging	0.79
R3107:Ankrd26	UTSW	6	118556243	missense	probably benign	0.01
R3419:Ankrd26	UTSW	6	118535107	missense	probably damaging	1.00
R3552:Ankrd26	UTSW	6	118507776	missense	probably damaging	1.00
R3899:Ankrd26	UTSW	6	118549428	missense	probably benign	0.30
R4157:Ankrd26	UTSW	6	118507821	missense	probably damaging	1.00
R4194:Ankrd26	UTSW	6	118523678	missense	probably benign	0.21
R4230:Ankrd26	UTSW	6	118559388	splice site	probably null
R4651:Ankrd26	UTSW	6	118515826	missense	probably benign	0.03
R4701:Ankrd26	UTSW	6	118506485	missense	possibly damaging	0.65
R4747:Ankrd26	UTSW	6	118527757	missense	probably benign	0.01
R4752:Ankrd26	UTSW	6	118540465	missense	probably null	1.00
R4834:Ankrd26	UTSW	6	118523718	missense	probably benign	0.08
R4835:Ankrd26	UTSW	6	118548850	nonsense	probably null
R4849:Ankrd26	UTSW	6	118532296	missense	probably benign	0.00
R5149:Ankrd26	UTSW	6	118558996	missense	probably benign	0.05
R5389:Ankrd26	UTSW	6	118508575	missense	possibly damaging	0.82
R5473:Ankrd26	UTSW	6	118515836	missense	probably benign	0.04
R5518:Ankrd26	UTSW	6	118548908	missense	probably benign	0.00
R5525:Ankrd26	UTSW	6	118527731	missense	probably benign	0.00
R5608:Ankrd26	UTSW	6	118511622	missense	probably damaging	1.00
R5639:Ankrd26	UTSW	6	118539724	missense	possibly damaging	0.72
R5704:Ankrd26	UTSW	6	118523882	missense	probably damaging	0.96
R5927:Ankrd26	UTSW	6	118507636	critical splice donor site	probably null
R5943:Ankrd26	UTSW	6	118505746	missense	probably damaging	1.00
R5976:Ankrd26	UTSW	6	118517894	critical splice donor site	probably null
R6181:Ankrd26	UTSW	6	118548877	missense	probably benign	0.15
R6478:Ankrd26	UTSW	6	118511638	missense	probably benign	0.28
R6865:Ankrd26	UTSW	6	118523481	missense	possibly damaging	0.90
R7224:Ankrd26	UTSW	6	118539727	missense	probably benign	0.07
R7287:Ankrd26	UTSW	6	118549637	critical splice donor site	probably null
R7301:Ankrd26	UTSW	6	118511663	missense	possibly damaging	0.62
R7348:Ankrd26	UTSW	6	118508564	missense	probably damaging	1.00
R7414:Ankrd26	UTSW	6	118508780	missense	possibly damaging	0.60
R7789:Ankrd26	UTSW	6	118527798	missense	probably damaging	0.98
R7789:Ankrd26	UTSW	6	118527799	missense	possibly damaging	0.82
R7964:Ankrd26	UTSW	6	118523199	missense	probably benign	0.03
R8078:Ankrd26	UTSW	6	118517893	splice site	probably null
R8224:Ankrd26	UTSW	6	118525755	missense	probably damaging	1.00
R8917:Ankrd26	UTSW	6	118558941	missense	probably damaging	1.00
R8962:Ankrd26	UTSW	6	118535143	missense	probably benign	0.02
R9072:Ankrd26	UTSW	6	118523389	missense	probably damaging	1.00
R9073:Ankrd26	UTSW	6	118523389	missense	probably damaging	1.00
R9087:Ankrd26	UTSW	6	118559269	critical splice donor site	probably null
R9334:Ankrd26	UTSW	6	118532301	missense	probably benign
R9417:Ankrd26	UTSW	6	118527764	missense	possibly damaging	0.46
R9521:Ankrd26	UTSW	6	118540459	missense	possibly damaging	0.94
R9720:Ankrd26	UTSW	6	118521941	missense	probably damaging	1.00
R9766:Ankrd26	UTSW	6	118523106	missense	possibly damaging	0.86
X0028:Ankrd26	UTSW	6	118507761	missense	probably damaging	1.00
Z1177:Ankrd26	UTSW	6	118523532	missense	possibly damaging	0.77
Z1177:Ankrd26	UTSW	6	118523595	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTAGTCTCACTGAAGACGATG -3'
(R):5'- CTGTCTTAATCCCAGCATCAGC -3'

Sequencing Primer
(F):5'- TGTAGAGCTAAAGCCCCGAGTTTC -3'
(R):5'- TTAATCCCAGCATCAGCATCTG -3'

Posted On

2018-07-23