Incidental Mutation 'R6667:Six5'
ID 527019
Institutional Source Beutler Lab
Gene Symbol Six5
Ensembl Gene ENSMUSG00000040841
Gene Name sine oculis-related homeobox 5
Synonyms Dmahp, MDMAHP, TrexBF
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 19094594-19098549 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19096569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 374 (N374D)
Ref Sequence ENSEMBL: ENSMUSP00000045973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000049454] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000127433] [ENSMUST00000141380] [ENSMUST00000154199]
AlphaFold P70178
Predicted Effect probably benign
Transcript: ENSMUST00000032568
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049454
AA Change: N374D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045973
Gene: ENSMUSG00000040841
AA Change: N374D

DomainStartEndE-ValueType
coiled coil region 14 48 N/A INTRINSIC
Pfam:SIX1_SD 79 189 1.4e-43 PFAM
HOX 194 256 3.11e-14 SMART
low complexity region 300 313 N/A INTRINSIC
low complexity region 347 358 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126264
Predicted Effect probably benign
Transcript: ENSMUST00000127433
SMART Domains Protein: ENSMUSP00000115597
Gene: ENSMUSG00000085601

DomainStartEndE-ValueType
Blast:HLH 20 57 1e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140742
Predicted Effect probably benign
Transcript: ENSMUST00000141380
SMART Domains Protein: ENSMUSP00000115575
Gene: ENSMUSG00000085601

DomainStartEndE-ValueType
HLH 20 74 6.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect probably benign
Transcript: ENSMUST00000154199
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148380
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeodomain-containing transcription factor that appears to function in the regulation of organogenesis. This gene is located downstream of the dystrophia myotonica-protein kinase gene. Mutations in this gene are a cause of branchiootorenal syndrome type 2. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mutants exhibit a high incidence of progressive cataracts with background-dependent penetrance. Heterozygotes exhibit a similar phenotype, but with reduced incidence and severity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Six5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Six5 APN 7 19097678 missense probably damaging 1.00
IGL01543:Six5 APN 7 19096347 missense possibly damaging 0.46
IGL02643:Six5 APN 7 19097530 missense probably benign 0.14
IGL03137:Six5 APN 7 19097147 unclassified probably benign
R0243:Six5 UTSW 7 19097022 splice site probably null
R0410:Six5 UTSW 7 19096456 missense probably damaging 1.00
R1942:Six5 UTSW 7 19096933 missense possibly damaging 0.68
R2055:Six5 UTSW 7 19095229 missense possibly damaging 0.78
R3726:Six5 UTSW 7 19096930 missense possibly damaging 0.86
R4801:Six5 UTSW 7 19096969 missense probably benign 0.19
R4802:Six5 UTSW 7 19096969 missense probably benign 0.19
R4898:Six5 UTSW 7 19095171 missense probably damaging 1.00
R6150:Six5 UTSW 7 19097521 missense probably benign 0.34
R6432:Six5 UTSW 7 19096771 missense probably damaging 1.00
R6736:Six5 UTSW 7 19094991 missense possibly damaging 0.83
R7101:Six5 UTSW 7 19094859 missense probably benign 0.01
R7253:Six5 UTSW 7 19094976 missense probably damaging 1.00
R7402:Six5 UTSW 7 19095043 missense probably damaging 1.00
R7719:Six5 UTSW 7 19096878 missense probably damaging 0.99
R8089:Six5 UTSW 7 19094872 missense probably damaging 1.00
R8748:Six5 UTSW 7 19095124 missense probably benign 0.00
R9182:Six5 UTSW 7 19097007 missense probably benign
R9283:Six5 UTSW 7 19095223 missense probably damaging 1.00
RF007:Six5 UTSW 7 19094937 missense probably benign 0.00
RF030:Six5 UTSW 7 19094800 unclassified probably benign
RF037:Six5 UTSW 7 19094800 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTGAATGGGAGCTTCCTGG -3'
(R):5'- TTATCAGGTGCACATTGGTAGGC -3'

Sequencing Primer
(F):5'- GGAGCTTCCTGGCCGCC -3'
(R):5'- TGCCACCTTCACAGGACTG -3'
Posted On 2018-07-23