Incidental Mutation 'R6667:Pvr'
ID 527021
Institutional Source Beutler Lab
Gene Symbol Pvr
Ensembl Gene ENSMUSG00000040511
Gene Name poliovirus receptor
Synonyms CD155, D7Ertd458e, mE4, necl-5, Taa1, Tage4
MMRRC Submission
Accession Numbers

Genbank: NM_027514 ; MGI: 107741

Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R6667 (G1)
Quality Score 220.009
Status Validated
Chromosome 7
Chromosomal Location 19903578-19921160 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 19905802 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 380 (Q380K)
Ref Sequence ENSEMBL: ENSMUSP00000039205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043517]
AlphaFold Q8K094
Predicted Effect probably benign
Transcript: ENSMUST00000043517
AA Change: Q380K

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039205
Gene: ENSMUSG00000040511
AA Change: Q380K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 35 142 1.58e-10 SMART
Pfam:C2-set_2 145 231 2e-18 PFAM
Pfam:C1-set 160 233 1.3e-5 PFAM
IG_like 254 334 6.75e1 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159413
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for one null allele have a reduced antibody response to oral immunization. Mice homozygous for a different null allele exhibit reduced susceptibility to chemically induced colon cancer. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Pvr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Pvr APN 7 19914859 missense probably damaging 1.00
IGL01700:Pvr APN 7 19909232 missense probably benign 0.11
IGL02536:Pvr APN 7 19918792 missense probably benign 0.17
F2404:Pvr UTSW 7 19905177 missense probably benign 0.06
R1016:Pvr UTSW 7 19909217 missense probably benign
R1470:Pvr UTSW 7 19918624 missense possibly damaging 0.51
R1470:Pvr UTSW 7 19918624 missense possibly damaging 0.51
R1525:Pvr UTSW 7 19910626 nonsense probably null
R2138:Pvr UTSW 7 19917002 missense probably damaging 1.00
R3912:Pvr UTSW 7 19909292 missense probably benign 0.01
R6724:Pvr UTSW 7 19918679 missense possibly damaging 0.95
R6855:Pvr UTSW 7 19909214 missense possibly damaging 0.92
R6866:Pvr UTSW 7 19918630 missense probably benign 0.01
R7030:Pvr UTSW 7 19905180 missense possibly damaging 0.84
R7158:Pvr UTSW 7 19918637 nonsense probably null
R7352:Pvr UTSW 7 19910616 missense possibly damaging 0.81
R8853:Pvr UTSW 7 19916972 missense possibly damaging 0.89
R9084:Pvr UTSW 7 19917012 missense possibly damaging 0.73
R9720:Pvr UTSW 7 19909196 nonsense probably null
X0025:Pvr UTSW 7 19910652 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CCATCAAGTAAACGGTCTTCCC -3'
(R):5'- TCTTCCCATGATTCCAGGGC -3'

Sequencing Primer
(F):5'- CAACCTTGGCTAGACAGTGAGTTC -3'
(R):5'- ATGATTCCAGGGCCTCGG -3'
Posted On 2018-07-23