Mutagenetix > Incidental Mutation

Incidental Mutation 'R6667:Ush1c'

527023

Institutional Source

Beutler Lab

Gene Symbol

Ush1c

Ensembl Gene

ENSMUSG00000030838

Gene Name

USH1 protein network component harmonin

Synonyms

harmonin, 2010016F01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6667 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46195350-46238503 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 46225624 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 139 (G139C)

Ref Sequence

ENSEMBL: ENSMUSP00000152126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009667] [ENSMUST00000078680] [ENSMUST00000143155] [ENSMUST00000154292] [ENSMUST00000176371] [ENSMUST00000177212] [ENSMUST00000222454]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000009667
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000009667
Gene: ENSMUSG00000030838
AA Change: G139C

Domain	Start	End	E-Value	Type
PDZ	96	168	3.06e-19	SMART
low complexity region	190	203	N/A	INTRINSIC
PDZ	220	292	5.62e-18	SMART
coiled coil region	301	376	N/A	INTRINSIC
coiled coil region	419	478	N/A	INTRINSIC
low complexity region	515	529	N/A	INTRINSIC
low complexity region	562	596	N/A	INTRINSIC
low complexity region	600	612	N/A	INTRINSIC
PDZ	762	841	1.13e-13	SMART
low complexity region	846	860	N/A	INTRINSIC
low complexity region	899	910	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000078680
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077747
Gene: ENSMUSG00000030838
AA Change: G139C

Domain	Start	End	E-Value	Type
PDZ	96	168	3.06e-19	SMART
low complexity region	190	203	N/A	INTRINSIC
PDZ	220	292	5.62e-18	SMART
coiled coil region	301	376	N/A	INTRINSIC
PDZ	458	537	1.13e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143155
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119676
Gene: ENSMUSG00000030838
AA Change: G139C

Domain	Start	End	E-Value	Type
PDZ	96	168	3.06e-19	SMART
low complexity region	190	203	N/A	INTRINSIC
PDZ	220	292	5.62e-18	SMART
coiled coil region	301	376	N/A	INTRINSIC
coiled coil region	419	478	N/A	INTRINSIC
low complexity region	515	529	N/A	INTRINSIC
low complexity region	562	596	N/A	INTRINSIC
low complexity region	600	612	N/A	INTRINSIC
PDZ	762	841	1.13e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000154292
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114494
Gene: ENSMUSG00000030838
AA Change: G139C

Domain	Start	End	E-Value	Type
PDZ	96	168	3.06e-19	SMART
low complexity region	190	203	N/A	INTRINSIC
PDZ	220	292	5.62e-18	SMART
coiled coil region	301	376	N/A	INTRINSIC
coiled coil region	419	478	N/A	INTRINSIC
low complexity region	515	529	N/A	INTRINSIC
low complexity region	562	596	N/A	INTRINSIC
low complexity region	600	612	N/A	INTRINSIC
PDZ	762	841	1.13e-13	SMART
low complexity region	846	860	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176371
AA Change: G108C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134783
Gene: ENSMUSG00000030838
AA Change: G108C

Domain	Start	End	E-Value	Type
PDZ	65	137	3.06e-19	SMART
low complexity region	159	172	N/A	INTRINSIC
PDZ	189	261	5.62e-18	SMART
coiled coil region	270	345	N/A	INTRINSIC
PDZ	427	506	1.13e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000177212
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135734
Gene: ENSMUSG00000030838
AA Change: G139C

Domain	Start	End	E-Value	Type
PDZ	96	168	3.06e-19	SMART
low complexity region	190	203	N/A	INTRINSIC
PDZ	220	291	6.13e-10	SMART
low complexity region	313	325	N/A	INTRINSIC
low complexity region	339	357	N/A	INTRINSIC
PDZ	439	518	1.13e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000222454
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions in the assembly of Usher protein complexes. The protein contains PDZ domains, a coiled-coil region with a bipartite nuclear localization signal and a PEST degradation sequence. Defects in this gene are the cause of Usher syndrome type 1C and non-syndromic sensorineural deafness autosomal recessive type 18. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mutations at this locus affect hearing and result in movement anomalies generally associated with vestibular mutants, such as head tossing and circling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3100002H09Rik	G	T	4: 124,610,642	A39E	probably damaging	Het
Agtr1b	T	A	3: 20,315,749	N231I	possibly damaging	Het
Alpk2	T	C	18: 65,307,740	E661G	probably damaging	Het
Ankrd26	C	T	6: 118,507,788	S1496N	probably benign	Het
Asah2	T	C	19: 31,995,358	N659S	probably benign	Het
Atp12a	T	C	14: 56,384,188	V760A	possibly damaging	Het
Casp2	T	C	6: 42,279,836	C343R	probably damaging	Het
Cblb	T	A	16: 52,152,644	M446K	possibly damaging	Het
Cipc	T	C	12: 86,962,090	V241A	probably benign	Het
Ddit4l	A	G	3: 137,626,121	K83E	probably benign	Het
E430018J23Rik	A	G	7: 127,393,423	M5T	probably benign	Het
Epc2	A	G	2: 49,522,669	T220A	probably damaging	Het
Epha5	T	C	5: 84,071,191	D741G	probably damaging	Het
Flg2	A	T	3: 93,201,761	R365S	possibly damaging	Het
Ggn	A	T	7: 29,172,668	H491L	possibly damaging	Het
Gm21119	T	C	8: 20,621,939	S267P	probably benign	Het
Gm8332	A	T	12: 88,249,705	D132E	unknown	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Ighv6-4	A	G	12: 114,406,532	V100A	probably benign	Het
Invs	A	T	4: 48,402,870	Y501F	possibly damaging	Het
Iqcm	G	T	8: 75,753,352	G313W	probably damaging	Het
Jph2	A	G	2: 163,376,286	S157P	probably damaging	Het
Mast4	T	C	13: 102,737,496	E1596G	probably damaging	Het
Mllt6	T	A	11: 97,676,934	L759Q	probably damaging	Het
Nalcn	A	G	14: 123,321,323	L837P	probably damaging	Het
Neb	G	A	2: 52,147,189	T6836I	probably damaging	Het
Nol12	T	A	15: 78,940,080	D133E	probably benign	Het
Olfr1136	A	G	2: 87,693,570	V104A	probably benign	Het
Oxtr	C	A	6: 112,477,099		probably benign	Het
Pcmt1	A	G	10: 7,663,149	L38P	probably damaging	Het
Pik3r2	T	C	8: 70,769,173	Y617C	probably damaging	Het
Prl7a2	T	C	13: 27,661,041	N121D	probably benign	Het
Pvr	G	T	7: 19,905,802	Q380K	probably benign	Het
Rtn2	A	G	7: 19,287,259	E188G	probably benign	Het
Setd4	C	A	16: 93,590,030	R260L	probably benign	Het
Six5	A	G	7: 19,096,569	N374D	probably benign	Het
Slc9b1	T	C	3: 135,371,965	I140T	probably damaging	Het
Supt16	A	G	14: 52,172,063	F797L	probably damaging	Het
Tbata	T	C	10: 61,185,363	L262P	probably damaging	Het
Tti1	A	T	2: 158,008,427	C297*	probably null	Het
Vmn1r1	C	T	1: 182,157,777	V108I	probably benign	Het
Vmn2r116	C	T	17: 23,401,092	T600I	probably damaging	Het
Zfp873	A	G	10: 82,060,589	T422A	probably benign	Het
Zfp943	G	A	17: 21,992,908	C325Y	probably damaging	Het

Other mutations in Ush1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ush1c	APN	7	46196770	missense	probably benign	0.00
IGL01074:Ush1c	APN	7	46225250	splice site	probably benign
IGL01099:Ush1c	APN	7	46205262	missense	probably damaging	0.99
IGL01107:Ush1c	APN	7	46209901	missense	probably damaging	1.00
IGL01446:Ush1c	APN	7	46208956	missense	possibly damaging	0.86
IGL02267:Ush1c	APN	7	46209298	missense	possibly damaging	0.92
IGL02307:Ush1c	APN	7	46197188	splice site	probably benign
IGL02448:Ush1c	APN	7	46209137	missense	possibly damaging	0.51
IGL02485:Ush1c	APN	7	46229250	missense	probably damaging	0.99
IGL02896:Ush1c	APN	7	46198415	missense	probably benign	0.00
IGL03031:Ush1c	APN	7	46224937	splice site	probably benign
R0085:Ush1c	UTSW	7	46225555	missense	probably benign	0.09
R0328:Ush1c	UTSW	7	46225448	splice site	probably benign
R0574:Ush1c	UTSW	7	46196804	missense	possibly damaging	0.68
R0600:Ush1c	UTSW	7	46224908	missense	probably benign	0.00
R1187:Ush1c	UTSW	7	46208914	missense	probably benign	0.01
R1406:Ush1c	UTSW	7	46225541	critical splice donor site	probably null
R1406:Ush1c	UTSW	7	46225541	critical splice donor site	probably null
R1716:Ush1c	UTSW	7	46195728	missense	probably benign	0.18
R1727:Ush1c	UTSW	7	46209231	missense	probably damaging	1.00
R1822:Ush1c	UTSW	7	46209901	missense	probably damaging	1.00
R1864:Ush1c	UTSW	7	46219392	nonsense	probably null
R2000:Ush1c	UTSW	7	46221433	missense	probably damaging	0.99
R2063:Ush1c	UTSW	7	46229481	missense	probably damaging	1.00
R2068:Ush1c	UTSW	7	46229481	missense	probably damaging	1.00
R2944:Ush1c	UTSW	7	46200982	missense	probably damaging	1.00
R4042:Ush1c	UTSW	7	46221528	missense	probably damaging	0.97
R4043:Ush1c	UTSW	7	46221528	missense	probably damaging	0.97
R4108:Ush1c	UTSW	7	46198445	missense	probably damaging	1.00
R4823:Ush1c	UTSW	7	46195733	missense	probably benign	0.00
R4862:Ush1c	UTSW	7	46229240	missense	probably damaging	1.00
R5534:Ush1c	UTSW	7	46221423	missense	probably damaging	1.00
R5922:Ush1c	UTSW	7	46204128	critical splice donor site	probably null
R6249:Ush1c	UTSW	7	46214959	missense	probably damaging	1.00
R6475:Ush1c	UTSW	7	46229219	missense	probably damaging	0.99
R6485:Ush1c	UTSW	7	46209110	missense	probably benign
R7177:Ush1c	UTSW	7	46229219	missense	probably damaging	0.99
R7419:Ush1c	UTSW	7	46229255	missense	probably damaging	1.00
R7424:Ush1c	UTSW	7	46225555	missense	probably benign	0.09
R7811:Ush1c	UTSW	7	46205286	nonsense	probably null
R7862:Ush1c	UTSW	7	46221424	missense	probably damaging	0.99
R8182:Ush1c	UTSW	7	46198351	critical splice donor site	probably null
R8340:Ush1c	UTSW	7	46211206	missense	probably benign	0.41
R8470:Ush1c	UTSW	7	46209250	missense	probably damaging	1.00
R8478:Ush1c	UTSW	7	46221433	missense	probably damaging	0.99
R9025:Ush1c	UTSW	7	46197190	splice site	probably benign
R9076:Ush1c	UTSW	7	46201056	missense	probably damaging	1.00
R9129:Ush1c	UTSW	7	46205205	missense	probably benign	0.23
R9398:Ush1c	UTSW	7	46220510	missense	probably benign	0.08
R9418:Ush1c	UTSW	7	46222868	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATCAGTCCGATGTCTGTGGG -3'
(R):5'- CTGAAAAGTGTTGCCTGCC -3'

Sequencing Primer
(F):5'- CCGATGTCTGTGGGGAGGAAAC -3'
(R):5'- GTGTTGCCTGCCGCTGTC -3'

Posted On

2018-07-23