Incidental Mutation 'R6667:Ush1c'
ID 527023
Institutional Source Beutler Lab
Gene Symbol Ush1c
Ensembl Gene ENSMUSG00000030838
Gene Name USH1 protein network component harmonin
Synonyms harmonin, 2010016F01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 46195350-46238503 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 46225624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 139 (G139C)
Ref Sequence ENSEMBL: ENSMUSP00000152126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009667] [ENSMUST00000078680] [ENSMUST00000143155] [ENSMUST00000154292] [ENSMUST00000176371] [ENSMUST00000177212] [ENSMUST00000222454]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000009667
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009667
Gene: ENSMUSG00000030838
AA Change: G139C

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
low complexity region 899 910 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078680
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077747
Gene: ENSMUSG00000030838
AA Change: G139C

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
PDZ 458 537 1.13e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143155
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119676
Gene: ENSMUSG00000030838
AA Change: G139C

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154292
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114494
Gene: ENSMUSG00000030838
AA Change: G139C

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176371
AA Change: G108C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134783
Gene: ENSMUSG00000030838
AA Change: G108C

DomainStartEndE-ValueType
PDZ 65 137 3.06e-19 SMART
low complexity region 159 172 N/A INTRINSIC
PDZ 189 261 5.62e-18 SMART
coiled coil region 270 345 N/A INTRINSIC
PDZ 427 506 1.13e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177212
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135734
Gene: ENSMUSG00000030838
AA Change: G139C

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 291 6.13e-10 SMART
low complexity region 313 325 N/A INTRINSIC
low complexity region 339 357 N/A INTRINSIC
PDZ 439 518 1.13e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222454
AA Change: G139C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions in the assembly of Usher protein complexes. The protein contains PDZ domains, a coiled-coil region with a bipartite nuclear localization signal and a PEST degradation sequence. Defects in this gene are the cause of Usher syndrome type 1C and non-syndromic sensorineural deafness autosomal recessive type 18. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mutations at this locus affect hearing and result in movement anomalies generally associated with vestibular mutants, such as head tossing and circling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Ush1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ush1c APN 7 46196770 missense probably benign 0.00
IGL01074:Ush1c APN 7 46225250 splice site probably benign
IGL01099:Ush1c APN 7 46205262 missense probably damaging 0.99
IGL01107:Ush1c APN 7 46209901 missense probably damaging 1.00
IGL01446:Ush1c APN 7 46208956 missense possibly damaging 0.86
IGL02267:Ush1c APN 7 46209298 missense possibly damaging 0.92
IGL02307:Ush1c APN 7 46197188 splice site probably benign
IGL02448:Ush1c APN 7 46209137 missense possibly damaging 0.51
IGL02485:Ush1c APN 7 46229250 missense probably damaging 0.99
IGL02896:Ush1c APN 7 46198415 missense probably benign 0.00
IGL03031:Ush1c APN 7 46224937 splice site probably benign
R0085:Ush1c UTSW 7 46225555 missense probably benign 0.09
R0328:Ush1c UTSW 7 46225448 splice site probably benign
R0574:Ush1c UTSW 7 46196804 missense possibly damaging 0.68
R0600:Ush1c UTSW 7 46224908 missense probably benign 0.00
R1187:Ush1c UTSW 7 46208914 missense probably benign 0.01
R1406:Ush1c UTSW 7 46225541 critical splice donor site probably null
R1406:Ush1c UTSW 7 46225541 critical splice donor site probably null
R1716:Ush1c UTSW 7 46195728 missense probably benign 0.18
R1727:Ush1c UTSW 7 46209231 missense probably damaging 1.00
R1822:Ush1c UTSW 7 46209901 missense probably damaging 1.00
R1864:Ush1c UTSW 7 46219392 nonsense probably null
R2000:Ush1c UTSW 7 46221433 missense probably damaging 0.99
R2063:Ush1c UTSW 7 46229481 missense probably damaging 1.00
R2068:Ush1c UTSW 7 46229481 missense probably damaging 1.00
R2944:Ush1c UTSW 7 46200982 missense probably damaging 1.00
R4042:Ush1c UTSW 7 46221528 missense probably damaging 0.97
R4043:Ush1c UTSW 7 46221528 missense probably damaging 0.97
R4108:Ush1c UTSW 7 46198445 missense probably damaging 1.00
R4823:Ush1c UTSW 7 46195733 missense probably benign 0.00
R4862:Ush1c UTSW 7 46229240 missense probably damaging 1.00
R5534:Ush1c UTSW 7 46221423 missense probably damaging 1.00
R5922:Ush1c UTSW 7 46204128 critical splice donor site probably null
R6249:Ush1c UTSW 7 46214959 missense probably damaging 1.00
R6475:Ush1c UTSW 7 46229219 missense probably damaging 0.99
R6485:Ush1c UTSW 7 46209110 missense probably benign
R7177:Ush1c UTSW 7 46229219 missense probably damaging 0.99
R7419:Ush1c UTSW 7 46229255 missense probably damaging 1.00
R7424:Ush1c UTSW 7 46225555 missense probably benign 0.09
R7811:Ush1c UTSW 7 46205286 nonsense probably null
R7862:Ush1c UTSW 7 46221424 missense probably damaging 0.99
R8182:Ush1c UTSW 7 46198351 critical splice donor site probably null
R8340:Ush1c UTSW 7 46211206 missense probably benign 0.41
R8470:Ush1c UTSW 7 46209250 missense probably damaging 1.00
R8478:Ush1c UTSW 7 46221433 missense probably damaging 0.99
R9025:Ush1c UTSW 7 46197190 splice site probably benign
R9076:Ush1c UTSW 7 46201056 missense probably damaging 1.00
R9129:Ush1c UTSW 7 46205205 missense probably benign 0.23
R9398:Ush1c UTSW 7 46220510 missense probably benign 0.08
R9418:Ush1c UTSW 7 46222868 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCAGTCCGATGTCTGTGGG -3'
(R):5'- CTGAAAAGTGTTGCCTGCC -3'

Sequencing Primer
(F):5'- CCGATGTCTGTGGGGAGGAAAC -3'
(R):5'- GTGTTGCCTGCCGCTGTC -3'
Posted On 2018-07-23