Mutagenetix > Incidental Mutation

Incidental Mutation 'R6667:Pik3r2'

527026

Institutional Source

Beutler Lab

Gene Symbol

Pik3r2

Ensembl Gene

ENSMUSG00000031834

Gene Name

phosphoinositide-3-kinase regulatory subunit 2

Synonyms

p85beta

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6667 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70768176-70776713 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70769173 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 617 (Y617C)

Ref Sequence

ENSEMBL: ENSMUSP00000034296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]

AlphaFold

O08908

PDB Structure

CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034296
AA Change: Y617C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: Y617C

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000034299

SMART Domains

Protein: ENSMUSP00000034299
Gene: ENSMUSG00000031838

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:GILT	60	163	4e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000143785
AA Change: Y34C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834
AA Change: Y34C

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	30	1e-8	BLAST
Pfam:SH2	33	70	4.5e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146707

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152545

Predicted Effect

probably benign
Transcript: ENSMUST00000154685

SMART Domains

Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
PDB:2XS6\|A	43	84	3e-11	PDB
SCOP:d1pbwa_	47	79	6e-9	SMART
Blast:RhoGAP	58	84	4e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212384

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222087

Meta Mutation Damage Score

0.9146

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3100002H09Rik	G	T	4: 124,610,642	A39E	probably damaging	Het
Agtr1b	T	A	3: 20,315,749	N231I	possibly damaging	Het
Alpk2	T	C	18: 65,307,740	E661G	probably damaging	Het
Ankrd26	C	T	6: 118,507,788	S1496N	probably benign	Het
Asah2	T	C	19: 31,995,358	N659S	probably benign	Het
Atp12a	T	C	14: 56,384,188	V760A	possibly damaging	Het
Casp2	T	C	6: 42,279,836	C343R	probably damaging	Het
Cblb	T	A	16: 52,152,644	M446K	possibly damaging	Het
Cipc	T	C	12: 86,962,090	V241A	probably benign	Het
Ddit4l	A	G	3: 137,626,121	K83E	probably benign	Het
E430018J23Rik	A	G	7: 127,393,423	M5T	probably benign	Het
Epc2	A	G	2: 49,522,669	T220A	probably damaging	Het
Epha5	T	C	5: 84,071,191	D741G	probably damaging	Het
Flg2	A	T	3: 93,201,761	R365S	possibly damaging	Het
Ggn	A	T	7: 29,172,668	H491L	possibly damaging	Het
Gm21119	T	C	8: 20,621,939	S267P	probably benign	Het
Gm8332	A	T	12: 88,249,705	D132E	unknown	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Ighv6-4	A	G	12: 114,406,532	V100A	probably benign	Het
Invs	A	T	4: 48,402,870	Y501F	possibly damaging	Het
Iqcm	G	T	8: 75,753,352	G313W	probably damaging	Het
Jph2	A	G	2: 163,376,286	S157P	probably damaging	Het
Mast4	T	C	13: 102,737,496	E1596G	probably damaging	Het
Mllt6	T	A	11: 97,676,934	L759Q	probably damaging	Het
Nalcn	A	G	14: 123,321,323	L837P	probably damaging	Het
Neb	G	A	2: 52,147,189	T6836I	probably damaging	Het
Nol12	T	A	15: 78,940,080	D133E	probably benign	Het
Olfr1136	A	G	2: 87,693,570	V104A	probably benign	Het
Oxtr	C	A	6: 112,477,099		probably benign	Het
Pcmt1	A	G	10: 7,663,149	L38P	probably damaging	Het
Prl7a2	T	C	13: 27,661,041	N121D	probably benign	Het
Pvr	G	T	7: 19,905,802	Q380K	probably benign	Het
Rtn2	A	G	7: 19,287,259	E188G	probably benign	Het
Setd4	C	A	16: 93,590,030	R260L	probably benign	Het
Six5	A	G	7: 19,096,569	N374D	probably benign	Het
Slc9b1	T	C	3: 135,371,965	I140T	probably damaging	Het
Supt16	A	G	14: 52,172,063	F797L	probably damaging	Het
Tbata	T	C	10: 61,185,363	L262P	probably damaging	Het
Tti1	A	T	2: 158,008,427	C297*	probably null	Het
Ush1c	C	A	7: 46,225,624	G139C	probably damaging	Het
Vmn1r1	C	T	1: 182,157,777	V108I	probably benign	Het
Vmn2r116	C	T	17: 23,401,092	T600I	probably damaging	Het
Zfp873	A	G	10: 82,060,589	T422A	probably benign	Het
Zfp943	G	A	17: 21,992,908	C325Y	probably damaging	Het

Other mutations in Pik3r2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Pik3r2	APN	8	70770429	missense	probably damaging	1.00
IGL01637:Pik3r2	APN	8	70772348	unclassified	probably benign
IGL02514:Pik3r2	APN	8	70770592	missense	probably benign	0.00
IGL03395:Pik3r2	APN	8	70772355	missense	probably benign
kingfisher	UTSW	8	70770901	missense	probably damaging	1.00
R0022:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R0022:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R0448:Pik3r2	UTSW	8	70772044	unclassified	probably benign
R1636:Pik3r2	UTSW	8	70771898	missense	probably benign
R1662:Pik3r2	UTSW	8	70770606	missense	probably damaging	1.00
R2114:Pik3r2	UTSW	8	70769385	missense	probably benign	0.31
R2879:Pik3r2	UTSW	8	70772385	missense	probably benign
R3830:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3852:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3859:Pik3r2	UTSW	8	70769986	missense	probably damaging	1.00
R3967:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3968:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3969:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3970:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R4606:Pik3r2	UTSW	8	70772136	nonsense	probably null
R4666:Pik3r2	UTSW	8	70768859	missense	possibly damaging	0.93
R5481:Pik3r2	UTSW	8	70769764	missense	probably benign	0.31
R6445:Pik3r2	UTSW	8	70772026	missense	probably benign	0.01
R6578:Pik3r2	UTSW	8	70772639	missense	probably benign	0.00
R6794:Pik3r2	UTSW	8	70770717	missense	probably benign	0.43
R6863:Pik3r2	UTSW	8	70770414	missense	probably damaging	1.00
R7378:Pik3r2	UTSW	8	70769381	missense	probably benign	0.03
R7750:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R7821:Pik3r2	UTSW	8	70769764	missense	probably damaging	1.00
R8056:Pik3r2	UTSW	8	70772367	missense	probably benign	0.14
R8237:Pik3r2	UTSW	8	70772150	missense	probably benign	0.00
R8414:Pik3r2	UTSW	8	70770435	missense	probably damaging	1.00
R8534:Pik3r2	UTSW	8	70774668	missense	probably benign
R8781:Pik3r2	UTSW	8	70769402	missense	possibly damaging	0.88
R8794:Pik3r2	UTSW	8	70771363	missense	probably benign
R9322:Pik3r2	UTSW	8	70774850	missense	possibly damaging	0.74
R9401:Pik3r2	UTSW	8	70771093	missense	possibly damaging	0.77
R9668:Pik3r2	UTSW	8	70768815	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAAATGGGTGCTCAATGC -3'
(R):5'- ATCAACGAATGGCTGGGAATC -3'

Sequencing Primer
(F):5'- TGCTCAATGCACACAATGGATTCG -3'
(R):5'- ACTGAGGAGTGAGTGATGTGC -3'

Posted On

2018-07-23