Incidental Mutation 'R6667:Pcmt1'
ID 527028
Institutional Source Beutler Lab
Gene Symbol Pcmt1
Ensembl Gene ENSMUSG00000019795
Gene Name protein-L-isoaspartate (D-aspartate) O-methyltransferase 1
Synonyms PIMT, protein carboxyl methyltransferase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R6667 (G1)
Quality Score 224.009
Status Validated
Chromosome 10
Chromosomal Location 7629373-7681136 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7663149 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 38 (L38P)
Ref Sequence ENSEMBL: ENSMUSP00000125144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040135] [ENSMUST00000159917] [ENSMUST00000159977] [ENSMUST00000161123] [ENSMUST00000162606] [ENSMUST00000162682] [ENSMUST00000163085]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040135
SMART Domains Protein: ENSMUSP00000046732
Gene: ENSMUSG00000040034

DomainStartEndE-ValueType
Blast:WD40 1 48 1e-15 BLAST
WD40 64 101 3.57e0 SMART
WD40 124 157 2.45e2 SMART
WD40 160 199 9.55e0 SMART
WD40 206 246 2.15e-4 SMART
WD40 250 290 2.19e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159917
AA Change: L52P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124932
Gene: ENSMUSG00000019795
AA Change: L52P

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 1.1e-88 PFAM
Pfam:Ubie_methyltran 126 258 3.4e-7 PFAM
Pfam:Methyltransf_31 134 284 1.1e-8 PFAM
Pfam:Methyltransf_18 136 241 3e-9 PFAM
Pfam:Methyltransf_11 141 239 1.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160517
Predicted Effect probably benign
Transcript: ENSMUST00000161123
AA Change: L39P

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124100
Gene: ENSMUSG00000019795
AA Change: L39P

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 53 108 4.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162527
Predicted Effect probably damaging
Transcript: ENSMUST00000162606
AA Change: L52P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123866
Gene: ENSMUSG00000019795
AA Change: L52P

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 2e-88 PFAM
Pfam:Ubie_methyltran 126 259 1e-6 PFAM
Pfam:Methyltransf_31 134 283 3.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162682
SMART Domains Protein: ENSMUSP00000124246
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 66 7.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163085
AA Change: L38P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125144
Gene: ENSMUSG00000019795
AA Change: L38P

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 52 265 9.1e-89 PFAM
Pfam:Ubie_methyltran 112 244 3.1e-7 PFAM
Pfam:Methyltransf_31 120 270 9.8e-9 PFAM
Pfam:Methyltransf_18 122 227 2.7e-9 PFAM
Pfam:Methyltransf_11 127 225 1.4e-6 PFAM
Meta Mutation Damage Score 0.2191 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene causes accumulation of modified proteins, growth retardation and fatal epileptic seizures. Homozygotes for one null allele also show a small spleen, altered lipid, hormone, mineral and enzyme profiles, kyphosis, enlarged brain and abnormal dendritic arborizations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Pcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02934:Pcmt1 APN 10 7640727 missense probably benign 0.00
R1968:Pcmt1 UTSW 10 7640710 nonsense probably null
R3889:Pcmt1 UTSW 10 7649050 critical splice donor site probably null
R5454:Pcmt1 UTSW 10 7640745 missense probably damaging 1.00
R5630:Pcmt1 UTSW 10 7649093 missense probably damaging 1.00
R5705:Pcmt1 UTSW 10 7638190 missense possibly damaging 0.86
R7163:Pcmt1 UTSW 10 7638158 missense probably benign 0.01
R7168:Pcmt1 UTSW 10 7638182 missense probably damaging 1.00
R7531:Pcmt1 UTSW 10 7680605 splice site probably null
R8012:Pcmt1 UTSW 10 7640763 missense probably benign 0.26
R8435:Pcmt1 UTSW 10 7640061 missense possibly damaging 0.94
R9134:Pcmt1 UTSW 10 7644443 splice site probably benign
R9140:Pcmt1 UTSW 10 7638914 makesense probably null
R9595:Pcmt1 UTSW 10 7649053 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TGCTAGTCCAGTCACCAGAAAC -3'
(R):5'- AACTGAGCAGCGTTCGTTTG -3'

Sequencing Primer
(F):5'- TCCACATCGCCGAGTGACAG -3'
(R):5'- ACCGAGCACTGGTTATCGC -3'
Posted On 2018-07-23