Incidental Mutation 'R6667:Tbata'
ID 527029
Institutional Source Beutler Lab
Gene Symbol Tbata
Ensembl Gene ENSMUSG00000020096
Gene Name thymus, brain and testes associated
Synonyms 1700021K02Rik, Spatial
MMRRC Submission 044787-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R6667 (G1)
Quality Score 162.009
Status Not validated
Chromosome 10
Chromosomal Location 61007743-61024620 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 61021142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 262 (L262P)
Ref Sequence ENSEMBL: ENSMUSP00000113902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035894] [ENSMUST00000079235] [ENSMUST00000121297] [ENSMUST00000122261] [ENSMUST00000126831] [ENSMUST00000131879] [ENSMUST00000140456] [ENSMUST00000143207] [ENSMUST00000148181] [ENSMUST00000151886]
AlphaFold Q7TSD4
Predicted Effect probably damaging
Transcript: ENSMUST00000035894
AA Change: L296P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036422
Gene: ENSMUSG00000020096
AA Change: L296P

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:SPATIAL 123 316 2.8e-64 PFAM
low complexity region 335 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079235
SMART Domains Protein: ENSMUSP00000078227
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
Pfam:SPATIAL 128 230 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121297
SMART Domains Protein: ENSMUSP00000113253
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Pfam:SPATIAL 82 191 2.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122261
AA Change: L262P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113902
Gene: ENSMUSG00000020096
AA Change: L262P

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Pfam:SPATIAL 82 282 6.7e-76 PFAM
low complexity region 301 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126831
SMART Domains Protein: ENSMUSP00000119957
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
Pfam:SPATIAL 1 155 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131879
SMART Domains Protein: ENSMUSP00000118942
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140456
Predicted Effect probably benign
Transcript: ENSMUST00000143207
Predicted Effect probably benign
Transcript: ENSMUST00000148181
Predicted Effect probably benign
Transcript: ENSMUST00000151886
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes a putative transcription factor that is highly expressed in thymic cortical stromal cells, and may be involved in T-cell development. Its expression is developmentally regulated in the testis, where it is restricted to the haploid round spermatids during spermatogenesis, and thus this gene may also have a role in the control of male germ cell development. Alternative splicing of this gene results in two sets of transcript variants: the variants containing 5 additional exons at the 3' end encode long isoforms that are highly expressed in the testis, while the variants lacking the 3' end exons encode short isoforms that are highly expressed in the thymus. Most of the transcripts encoding the short isoforms have been shown to initiate translation from non-AUG (CUG) start sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased thymic pithelial cells and total thymocyte numbers without altering T cell development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,504,435 (GRCm39) A39E probably damaging Het
Agtr1b T A 3: 20,369,913 (GRCm39) N231I possibly damaging Het
Alpk2 T C 18: 65,440,811 (GRCm39) E661G probably damaging Het
Ankrd26 C T 6: 118,484,749 (GRCm39) S1496N probably benign Het
Asah2 T C 19: 31,972,758 (GRCm39) N659S probably benign Het
Atp12a T C 14: 56,621,645 (GRCm39) V760A possibly damaging Het
Casp2 T C 6: 42,256,770 (GRCm39) C343R probably damaging Het
Cblb T A 16: 51,973,007 (GRCm39) M446K possibly damaging Het
Cipc T C 12: 87,008,864 (GRCm39) V241A probably benign Het
Ddit4l A G 3: 137,331,882 (GRCm39) K83E probably benign Het
Eif1ad10 A T 12: 88,216,475 (GRCm39) D132E unknown Het
Epc2 A G 2: 49,412,681 (GRCm39) T220A probably damaging Het
Epha5 T C 5: 84,219,050 (GRCm39) D741G probably damaging Het
Flg2 A T 3: 93,109,068 (GRCm39) R365S possibly damaging Het
Ggn A T 7: 28,872,093 (GRCm39) H491L possibly damaging Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Ighv6-4 A G 12: 114,370,152 (GRCm39) V100A probably benign Het
Invs A T 4: 48,402,870 (GRCm39) Y501F possibly damaging Het
Iqcm G T 8: 76,479,980 (GRCm39) G313W probably damaging Het
Jph2 A G 2: 163,218,206 (GRCm39) S157P probably damaging Het
Mast4 T C 13: 102,874,004 (GRCm39) E1596G probably damaging Het
Mllt6 T A 11: 97,567,760 (GRCm39) L759Q probably damaging Het
Nalcn A G 14: 123,558,735 (GRCm39) L837P probably damaging Het
Neb G A 2: 52,037,201 (GRCm39) T6836I probably damaging Het
Nol12 T A 15: 78,824,280 (GRCm39) D133E probably benign Het
Or5w13 A G 2: 87,523,914 (GRCm39) V104A probably benign Het
Oxtr C A 6: 112,454,060 (GRCm39) probably benign Het
Pcmt1 A G 10: 7,538,913 (GRCm39) L38P probably damaging Het
Pik3r2 T C 8: 71,221,817 (GRCm39) Y617C probably damaging Het
Potefam3b T C 8: 21,161,955 (GRCm39) S267P probably benign Het
Prl7a2 T C 13: 27,845,024 (GRCm39) N121D probably benign Het
Pvr G T 7: 19,639,727 (GRCm39) Q380K probably benign Het
Rtn2 A G 7: 19,021,184 (GRCm39) E188G probably benign Het
Setd4 C A 16: 93,386,918 (GRCm39) R260L probably benign Het
Six5 A G 7: 18,830,494 (GRCm39) N374D probably benign Het
Slc9b1 T C 3: 135,077,726 (GRCm39) I140T probably damaging Het
Supt16 A G 14: 52,409,520 (GRCm39) F797L probably damaging Het
Tti1 A T 2: 157,850,347 (GRCm39) C297* probably null Het
Ush1c C A 7: 45,875,048 (GRCm39) G139C probably damaging Het
Vmn1r1 C T 1: 181,985,342 (GRCm39) V108I probably benign Het
Vmn2r116 C T 17: 23,620,066 (GRCm39) T600I probably damaging Het
Zfp764l1 A G 7: 126,992,595 (GRCm39) M5T probably benign Het
Zfp873 A G 10: 81,896,423 (GRCm39) T422A probably benign Het
Zfp943 G A 17: 22,211,889 (GRCm39) C325Y probably damaging Het
Other mutations in Tbata
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Tbata APN 10 61,011,739 (GRCm39) nonsense probably null
IGL02311:Tbata APN 10 61,015,234 (GRCm39) nonsense probably null
R0417:Tbata UTSW 10 61,016,118 (GRCm39) missense probably damaging 1.00
R1537:Tbata UTSW 10 61,019,270 (GRCm39) splice site probably null
R1956:Tbata UTSW 10 61,019,256 (GRCm39) missense probably damaging 0.99
R1959:Tbata UTSW 10 61,011,623 (GRCm39) missense possibly damaging 0.86
R2138:Tbata UTSW 10 61,015,063 (GRCm39) missense probably benign 0.40
R4835:Tbata UTSW 10 61,019,132 (GRCm39) missense probably damaging 1.00
R6261:Tbata UTSW 10 61,011,644 (GRCm39) missense possibly damaging 0.92
R7355:Tbata UTSW 10 61,010,099 (GRCm39) unclassified probably benign
R7863:Tbata UTSW 10 61,011,521 (GRCm39) missense probably benign 0.02
R9607:Tbata UTSW 10 61,011,626 (GRCm39) missense probably benign
X0066:Tbata UTSW 10 61,024,384 (GRCm39) missense probably damaging 1.00
Z1191:Tbata UTSW 10 61,022,172 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGGAGGAACCTTTAGGGGAACC -3'
(R):5'- GTATCTGCCCTGCGAATCAG -3'

Sequencing Primer
(F):5'- GAACCAGTTTGCCACGCC -3'
(R):5'- CTGCGAATCAGGAACAAGATC -3'
Posted On 2018-07-23