Incidental Mutation 'R6667:Zfp873'
ID 527030
Institutional Source Beutler Lab
Gene Symbol Zfp873
Ensembl Gene ENSMUSG00000061371
Gene Name zinc finger protein 873
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R6667 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 82048123-82064745 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82060589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 422 (T422A)
Ref Sequence ENSEMBL: ENSMUSP00000148219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105313] [ENSMUST00000209622] [ENSMUST00000210325]
AlphaFold A0A1B0GT64
Predicted Effect probably benign
Transcript: ENSMUST00000105313
AA Change: T385A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000100950
Gene: ENSMUSG00000061371
AA Change: T385A

DomainStartEndE-ValueType
ZnF_C2H2 68 90 1.12e2 SMART
ZnF_C2H2 96 117 4.69e0 SMART
ZnF_C2H2 123 145 2.06e1 SMART
ZnF_C2H2 151 173 5.5e-3 SMART
ZnF_C2H2 179 201 3.69e-4 SMART
ZnF_C2H2 207 229 3.89e-3 SMART
ZnF_C2H2 235 257 9.88e-5 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 2.99e-4 SMART
ZnF_C2H2 319 341 1.95e-3 SMART
ZnF_C2H2 347 369 2.75e-3 SMART
ZnF_C2H2 375 397 7.37e-4 SMART
ZnF_C2H2 403 425 2.53e-2 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 5.99e-4 SMART
ZnF_C2H2 487 509 1.22e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.53e-2 SMART
ZnF_C2H2 571 593 9.73e-4 SMART
ZnF_C2H2 599 619 3.13e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209614
Predicted Effect probably benign
Transcript: ENSMUST00000209622
Predicted Effect probably benign
Transcript: ENSMUST00000210325
AA Change: T422A

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219748
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Zfp873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02250:Zfp873 APN 10 82058418 start codon destroyed probably null 0.45
G1Funyon:Zfp873 UTSW 10 82060879 missense probably damaging 1.00
R0666:Zfp873 UTSW 10 82060761 missense possibly damaging 0.75
R1568:Zfp873 UTSW 10 82060279 missense probably damaging 1.00
R1739:Zfp873 UTSW 10 82060707 missense probably damaging 1.00
R1848:Zfp873 UTSW 10 82060572 missense probably benign 0.33
R1892:Zfp873 UTSW 10 82061246 missense probably damaging 1.00
R2061:Zfp873 UTSW 10 82060157 missense probably benign 0.01
R3735:Zfp873 UTSW 10 82061181 missense probably benign 0.15
R4422:Zfp873 UTSW 10 82060874 missense probably benign 0.13
R4674:Zfp873 UTSW 10 82059980 missense possibly damaging 0.53
R4839:Zfp873 UTSW 10 82060519 missense probably damaging 0.98
R5146:Zfp873 UTSW 10 82060224 missense probably damaging 1.00
R5154:Zfp873 UTSW 10 82060191 missense possibly damaging 0.54
R5160:Zfp873 UTSW 10 82061042 missense possibly damaging 0.54
R5811:Zfp873 UTSW 10 82060733 missense probably damaging 1.00
R6625:Zfp873 UTSW 10 82060304 missense probably damaging 1.00
R6742:Zfp873 UTSW 10 82058422 missense probably damaging 1.00
R6878:Zfp873 UTSW 10 82060695 missense probably benign 0.33
R7055:Zfp873 UTSW 10 82059998 missense probably damaging 1.00
R7296:Zfp873 UTSW 10 82061237 missense probably damaging 1.00
R7381:Zfp873 UTSW 10 82060971 missense probably damaging 1.00
R7448:Zfp873 UTSW 10 82060627 missense probably damaging 1.00
R7464:Zfp873 UTSW 10 82060376 missense possibly damaging 0.51
R7470:Zfp873 UTSW 10 82059939 missense probably benign 0.19
R7640:Zfp873 UTSW 10 82060275 missense possibly damaging 0.72
R7862:Zfp873 UTSW 10 82060275 missense probably benign 0.03
R8017:Zfp873 UTSW 10 82060359 missense probably benign 0.01
R8301:Zfp873 UTSW 10 82060879 missense probably damaging 1.00
R8765:Zfp873 UTSW 10 82060238 missense probably damaging 1.00
R8997:Zfp873 UTSW 10 82061156 missense probably benign 0.03
R9305:Zfp873 UTSW 10 82060680 missense probably benign 0.00
R9462:Zfp873 UTSW 10 82061297 missense probably benign 0.31
Z1177:Zfp873 UTSW 10 82061165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAAACCCTATGATTGCACTG -3'
(R):5'- TAGGGCTTCTCTCCAGTGTGATG -3'

Sequencing Primer
(F):5'- ACCCTATGATTGCACTGAATGTGG -3'
(R):5'- TCATGGTATTGAAGACTAGCACGAC -3'
Posted On 2018-07-23