Incidental Mutation 'R6667:Eif1ad10'
ID 527033
Institutional Source Beutler Lab
Gene Symbol Eif1ad10
Ensembl Gene ENSMUSG00000095799
Gene Name eukaryotic translation initiation factor 1A domain containing 10
Synonyms Gm8332
MMRRC Submission 044787-MU
Accession Numbers
Essential gene? Not available question?
Stock # R6667 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 88216436-88216870 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 88216475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 132 (D132E)
Ref Sequence ENSEMBL: ENSMUSP00000136709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179468]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000179468
AA Change: D132E
SMART Domains Protein: ENSMUSP00000136709
Gene: ENSMUSG00000095799
AA Change: D132E

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
eIF1a 28 110 2.58e-46 SMART
low complexity region 125 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221854
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,504,435 (GRCm39) A39E probably damaging Het
Agtr1b T A 3: 20,369,913 (GRCm39) N231I possibly damaging Het
Alpk2 T C 18: 65,440,811 (GRCm39) E661G probably damaging Het
Ankrd26 C T 6: 118,484,749 (GRCm39) S1496N probably benign Het
Asah2 T C 19: 31,972,758 (GRCm39) N659S probably benign Het
Atp12a T C 14: 56,621,645 (GRCm39) V760A possibly damaging Het
Casp2 T C 6: 42,256,770 (GRCm39) C343R probably damaging Het
Cblb T A 16: 51,973,007 (GRCm39) M446K possibly damaging Het
Cipc T C 12: 87,008,864 (GRCm39) V241A probably benign Het
Ddit4l A G 3: 137,331,882 (GRCm39) K83E probably benign Het
Epc2 A G 2: 49,412,681 (GRCm39) T220A probably damaging Het
Epha5 T C 5: 84,219,050 (GRCm39) D741G probably damaging Het
Flg2 A T 3: 93,109,068 (GRCm39) R365S possibly damaging Het
Ggn A T 7: 28,872,093 (GRCm39) H491L possibly damaging Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Ighv6-4 A G 12: 114,370,152 (GRCm39) V100A probably benign Het
Invs A T 4: 48,402,870 (GRCm39) Y501F possibly damaging Het
Iqcm G T 8: 76,479,980 (GRCm39) G313W probably damaging Het
Jph2 A G 2: 163,218,206 (GRCm39) S157P probably damaging Het
Mast4 T C 13: 102,874,004 (GRCm39) E1596G probably damaging Het
Mllt6 T A 11: 97,567,760 (GRCm39) L759Q probably damaging Het
Nalcn A G 14: 123,558,735 (GRCm39) L837P probably damaging Het
Neb G A 2: 52,037,201 (GRCm39) T6836I probably damaging Het
Nol12 T A 15: 78,824,280 (GRCm39) D133E probably benign Het
Or5w13 A G 2: 87,523,914 (GRCm39) V104A probably benign Het
Oxtr C A 6: 112,454,060 (GRCm39) probably benign Het
Pcmt1 A G 10: 7,538,913 (GRCm39) L38P probably damaging Het
Pik3r2 T C 8: 71,221,817 (GRCm39) Y617C probably damaging Het
Potefam3b T C 8: 21,161,955 (GRCm39) S267P probably benign Het
Prl7a2 T C 13: 27,845,024 (GRCm39) N121D probably benign Het
Pvr G T 7: 19,639,727 (GRCm39) Q380K probably benign Het
Rtn2 A G 7: 19,021,184 (GRCm39) E188G probably benign Het
Setd4 C A 16: 93,386,918 (GRCm39) R260L probably benign Het
Six5 A G 7: 18,830,494 (GRCm39) N374D probably benign Het
Slc9b1 T C 3: 135,077,726 (GRCm39) I140T probably damaging Het
Supt16 A G 14: 52,409,520 (GRCm39) F797L probably damaging Het
Tbata T C 10: 61,021,142 (GRCm39) L262P probably damaging Het
Tti1 A T 2: 157,850,347 (GRCm39) C297* probably null Het
Ush1c C A 7: 45,875,048 (GRCm39) G139C probably damaging Het
Vmn1r1 C T 1: 181,985,342 (GRCm39) V108I probably benign Het
Vmn2r116 C T 17: 23,620,066 (GRCm39) T600I probably damaging Het
Zfp764l1 A G 7: 126,992,595 (GRCm39) M5T probably benign Het
Zfp873 A G 10: 81,896,423 (GRCm39) T422A probably benign Het
Zfp943 G A 17: 22,211,889 (GRCm39) C325Y probably damaging Het
Other mutations in Eif1ad10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1742:Eif1ad10 UTSW 12 88,216,453 (GRCm39) missense unknown
R3872:Eif1ad10 UTSW 12 88,216,476 (GRCm39) missense unknown
R3873:Eif1ad10 UTSW 12 88,216,476 (GRCm39) missense unknown
R3875:Eif1ad10 UTSW 12 88,216,476 (GRCm39) missense unknown
R5784:Eif1ad10 UTSW 12 88,216,525 (GRCm39) missense probably damaging 1.00
R6447:Eif1ad10 UTSW 12 88,216,494 (GRCm39) missense unknown
R7670:Eif1ad10 UTSW 12 88,216,524 (GRCm39) missense probably benign 0.14
R7852:Eif1ad10 UTSW 12 88,216,588 (GRCm39) missense probably damaging 1.00
R8508:Eif1ad10 UTSW 12 88,216,455 (GRCm39) missense unknown
Z1177:Eif1ad10 UTSW 12 88,216,572 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGAAGTCCCTTAACAGTGC -3'
(R):5'- CCAAAATGCTGGGATGTGGAC -3'

Sequencing Primer
(F):5'- AGTGCACACTGCTCTGC -3'
(R):5'- CTGTGCCACATAAGAGGGAAGTTG -3'
Posted On 2018-07-23